ID: 1114355431

View in Genome Browser
Species Human (GRCh38)
Location 14:21903052-21903074
Sequence CTGAGCAATGGAAACACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114355431_1114355438 9 Left 1114355431 14:21903052-21903074 CCTGCAGTGTTTCCATTGCTCAG No data
Right 1114355438 14:21903084-21903106 TGGTGCTCATCCCACTGCTGGGG No data
1114355431_1114355437 8 Left 1114355431 14:21903052-21903074 CCTGCAGTGTTTCCATTGCTCAG No data
Right 1114355437 14:21903083-21903105 CTGGTGCTCATCCCACTGCTGGG No data
1114355431_1114355436 7 Left 1114355431 14:21903052-21903074 CCTGCAGTGTTTCCATTGCTCAG No data
Right 1114355436 14:21903082-21903104 CCTGGTGCTCATCCCACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114355431 Original CRISPR CTGAGCAATGGAAACACTGC AGG (reversed) Intergenic
No off target data available for this crispr