ID: 1114360291

View in Genome Browser
Species Human (GRCh38)
Location 14:21964676-21964698
Sequence TACAATAAACATGAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 524
Summary {0: 1, 1: 0, 2: 11, 3: 64, 4: 448}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114360288_1114360291 29 Left 1114360288 14:21964624-21964646 CCAGTAGATAGACACTTTGTTGA 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1114360291 14:21964676-21964698 TACAATAAACATGAGGAGGCAGG 0: 1
1: 0
2: 11
3: 64
4: 448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114360291 Original CRISPR TACAATAAACATGAGGAGGC AGG Intergenic
902183223 1:14705471-14705493 TGCAATAAACATGGGGGTGCAGG - Intronic
903516482 1:23914389-23914411 TAAAATAAACAGGAAGTGGCTGG - Intergenic
904834584 1:33326981-33327003 TAAAATAAAAAGGAGGAAGCAGG + Intronic
906094607 1:43213492-43213514 TACAATAAATATGGGGGGGGCGG + Intronic
907578074 1:55546497-55546519 TACAAGAAAGATGGGGAGGCAGG + Intergenic
908102213 1:60803145-60803167 TACAATAAACATGGGGATGCAGG + Intergenic
908436907 1:64115856-64115878 TACAAGAATCATGCAGAGGCAGG - Intronic
908670317 1:66539656-66539678 TATTCTAAACATGAGGAGGCAGG - Intronic
909030876 1:70538111-70538133 TGCAATAAACATGAGAGTGCAGG + Intergenic
910155855 1:84218605-84218627 TGCAATAAACATGAGGATTCAGG + Intronic
910673105 1:89792955-89792977 TGCAATGAACATGAGGGTGCAGG - Intronic
910721398 1:90290267-90290289 TGCTATAAACATGAGGGTGCAGG - Intergenic
910853874 1:91674621-91674643 TTCCATAAACATGGGGAGGGAGG + Intergenic
911082509 1:93947328-93947350 TGCAATAAACATGGGGGTGCAGG + Intergenic
911104167 1:94117119-94117141 TTCAATCAACATGGGGAGGAGGG + Intronic
911230177 1:95352743-95352765 AACAATAAAGAAGAGGAAGCTGG - Intergenic
911343355 1:96667014-96667036 TGCAATATACATGAGAATGCAGG + Intergenic
912644479 1:111379275-111379297 TGCAATAAACATGTGAATGCAGG + Intergenic
913100953 1:115564964-115564986 TATAAAAAACATTAGGAGGAAGG + Intergenic
913380005 1:118200124-118200146 TACGAAAAGCATGAGGAGGAAGG + Intergenic
913556390 1:119971474-119971496 GACCAAAAAGATGAGGAGGCTGG + Intronic
914333120 1:146690740-146690762 TAGATTAATCATGTGGAGGCCGG - Intergenic
914982080 1:152423950-152423972 CACACTAAAGATGAGGAGGAAGG - Intergenic
916301715 1:163282825-163282847 TGCAATAAACATGGGGGTGCAGG - Intronic
916493690 1:165326137-165326159 TCCAATAGGCATGAGAAGGCTGG + Intronic
916617803 1:166460598-166460620 TGCAATAAACATGAGAGTGCAGG + Intergenic
916883131 1:169041719-169041741 TGCAATAAACATGAGAGTGCAGG - Intergenic
916915026 1:169397185-169397207 TAAAATGAACATGAGGAAGGAGG + Intronic
918588037 1:186210338-186210360 TACAATAGACACAGGGAGGCAGG - Intergenic
919012174 1:191979257-191979279 TGCAATAAACATGTGAATGCAGG + Intergenic
919044454 1:192433269-192433291 TGCAATAAACATGAGGGTACAGG - Intergenic
920207773 1:204305409-204305431 TACAATATAGATGAGGAAACTGG - Intronic
921390811 1:214611660-214611682 TACAATAAGAATTAGAAGGCTGG - Intronic
922773086 1:228199856-228199878 TGCAATAAACATGGGGGTGCAGG - Intergenic
923310733 1:232732297-232732319 TAAAATAAACAAGAGGGGCCTGG - Intergenic
924488106 1:244507205-244507227 TACAATAAACATGGGGGTTCAGG + Intronic
1064575165 10:16738148-16738170 TACACTAAAAAAGAAGAGGCCGG + Intronic
1065518328 10:26546846-26546868 TGCAATAAACATGAGAGGGCAGG + Intronic
1066563892 10:36699505-36699527 CACAAGAAAAATGATGAGGCAGG + Intergenic
1067840663 10:49675808-49675830 TGCAATAAACATGAGAGTGCAGG - Intergenic
1067959482 10:50832105-50832127 TTCAATAAACATGGGAATGCAGG - Intronic
1068066159 10:52134719-52134741 TAGAATGAACCTGAGGAGCCAGG + Intronic
1068506840 10:57911461-57911483 TATATTAAACATAAGGATGCTGG + Intergenic
1068641025 10:59408183-59408205 TGCAATAAACATGAGAGGGCAGG + Intergenic
1069221347 10:65887956-65887978 TACAAGAAACATGAAAAAGCAGG - Intergenic
1069256817 10:66343266-66343288 CACAATAAACATGAGAGTGCAGG - Intronic
1069285324 10:66707522-66707544 TACAATTAAGATGAGCAGCCAGG - Intronic
1069533124 10:69233538-69233560 TAGAAGAAACATGGGAAGGCTGG + Intronic
1070113785 10:73509709-73509731 TAAAATAATCTAGAGGAGGCTGG + Intronic
1070738749 10:78887276-78887298 TACAGAAAATATGAGGAGGTTGG - Intergenic
1070861078 10:79662733-79662755 TATAACAAGCATGTGGAGGCAGG - Intergenic
1070876179 10:79812857-79812879 TATAAAAAGCATGTGGAGGCAGG + Intergenic
1071122625 10:82297231-82297253 TACAATAAACATAAAAATGCAGG + Intronic
1071643109 10:87335005-87335027 TATAACAAGCATGTGGAGGCAGG + Intergenic
1072294930 10:93999752-93999774 TCCAATAAACAGGCAGAGGCGGG - Intronic
1072385217 10:94918142-94918164 TGCAATAAACATGGGAATGCAGG + Intergenic
1072709848 10:97709043-97709065 TACAATAAAAATGATGATGGTGG - Intergenic
1073813563 10:107178913-107178935 TGCAATAAACATGAGGGTTCAGG + Intergenic
1074283683 10:112078097-112078119 TAAAATAAATTTGAGGAGGGAGG + Intergenic
1074460003 10:113628166-113628188 TAAAATAAAAATGAAGAGGTTGG - Intronic
1074633576 10:115288178-115288200 TGCAATAAACATGAGAATGCAGG + Intronic
1077450611 11:2641117-2641139 TGCAATAAACACGGGGATGCAGG + Intronic
1078124470 11:8546883-8546905 TGCAATAAACATGGGAATGCAGG + Intronic
1078348364 11:10571793-10571815 TGCAATAAACATGAGGGTGCAGG + Intronic
1078437011 11:11333781-11333803 TACAAGAAATATGAGGAAGGGGG - Intronic
1078881919 11:15459805-15459827 TGCAATGAACATGAGAGGGCAGG + Intergenic
1078912040 11:15741663-15741685 CAAAATAAACAAGATGAGGCTGG - Intergenic
1079482266 11:20893883-20893905 CAAACTAAACATGAGAAGGCTGG + Intronic
1079514219 11:21248046-21248068 TACAAAAAAGAGCAGGAGGCCGG + Intronic
1080357410 11:31466443-31466465 TGCAATAAACATGAGGATGCAGG - Intronic
1081049617 11:38321898-38321920 TGCAATAAACATGAGAGTGCAGG - Intergenic
1082263239 11:50093861-50093883 TACAAAAAAGAAAAGGAGGCTGG + Intergenic
1082766363 11:57171065-57171087 TGCAATAAACATGGGAATGCAGG + Intergenic
1084622491 11:70282458-70282480 TAGAATAAACATTAGGTAGCTGG - Intronic
1085060582 11:73442420-73442442 TACATTAAAAAAGAAGAGGCCGG - Intronic
1085420696 11:76356347-76356369 AACAAGAAACATCAGCAGGCTGG + Intronic
1085543139 11:77291060-77291082 TGCAATAAACATAGGGATGCAGG - Intronic
1086015712 11:82164774-82164796 TTCCATAAACTTGAGGAGGAGGG + Intergenic
1086958976 11:92962950-92962972 TGCAATAAACATGAGCATGCAGG - Intergenic
1088154582 11:106787834-106787856 TACAATAAACATGGGAGTGCAGG + Intronic
1089889824 11:121869824-121869846 TTCAATAAACATGAGGAAATGGG - Intergenic
1090135276 11:124191443-124191465 TTCAATAAAAGTGTGGAGGCTGG + Intergenic
1090537935 11:127665784-127665806 TGCACTAAACATGAGGAGTATGG + Intergenic
1091336424 11:134771603-134771625 TGCAATAAACATGGGGGTGCAGG - Intergenic
1092097701 12:5857323-5857345 TGCAATAAACATGGGGGTGCAGG + Intronic
1093514458 12:19969737-19969759 GACAATGGAGATGAGGAGGCAGG - Intergenic
1093681099 12:22004444-22004466 TGCAATAAACATGAGGACGCAGG + Intergenic
1096279733 12:50242471-50242493 TCCAGGAAACAGGAGGAGGCCGG - Intronic
1097369110 12:58754381-58754403 TGCAATAAACATGTGAATGCAGG - Intronic
1097498129 12:60368855-60368877 TGCAATAAACATGAGTTTGCAGG - Intergenic
1097652022 12:62310678-62310700 TACAATAAACATGTGAGTGCAGG + Intronic
1098460246 12:70725122-70725144 TAAAATAAGCATGAAGAGACAGG + Intronic
1098947110 12:76601299-76601321 AATAAAAAACATGATGAGGCTGG + Intergenic
1099362645 12:81724779-81724801 TGCAATAAACATAAGGGGGAAGG + Intronic
1099381976 12:81965950-81965972 TACAATGAACATGAAAATGCAGG - Intergenic
1099421829 12:82471317-82471339 GGTAACAAACATGAGGAGGCAGG - Intronic
1099506756 12:83487112-83487134 TGCAATAAACATGGGGGTGCAGG + Intergenic
1099782939 12:87223044-87223066 TGCAATAAACATGGGAATGCAGG + Intergenic
1100024872 12:90115752-90115774 TGAAATAAACATGAGGATGAAGG + Intergenic
1100133188 12:91521331-91521353 TACAATAAACATACGTATGCAGG - Intergenic
1101302174 12:103494501-103494523 TAAAATAAAAAGGAGGAGGATGG + Intronic
1101363974 12:104054563-104054585 AGCAATGAACATGGGGAGGCAGG - Intronic
1102693970 12:114783585-114783607 TACAATAAAAAGGATGGGGCTGG - Intergenic
1102869602 12:116403196-116403218 TACATTCAACATGGGCAGGCTGG + Intergenic
1103198570 12:119067954-119067976 TGCAATATAGATGGGGAGGCCGG - Intronic
1104769436 12:131351781-131351803 TCCAATCACCATGATGAGGCTGG - Intergenic
1106051405 13:26193305-26193327 TAAAAAAAAAATGAGGAGCCAGG + Intronic
1106558374 13:30829104-30829126 TACAATGGCCATGTGGAGGCAGG - Intergenic
1106794633 13:33191836-33191858 TCTAATAAAAATGAGAAGGCAGG + Intronic
1107095925 13:36535228-36535250 TACAATACACATGAGAATGTAGG + Intergenic
1109619734 13:64888161-64888183 TGCAATAAACATGTGAATGCAGG - Intergenic
1110754766 13:79159648-79159670 TGCAATAAACATGAGGGTGCAGG + Intergenic
1111007501 13:82267371-82267393 TACAATGAACATGGGAATGCAGG - Intergenic
1111431135 13:88149657-88149679 TATAGAAAACATGAAGAGGCAGG + Intergenic
1111556741 13:89890666-89890688 TACAATGAACATGAGAGTGCAGG - Intergenic
1111722154 13:91959500-91959522 TTCCAAAAACATGAGGAGGAAGG + Intronic
1112060025 13:95729495-95729517 TGCAATAAACATGAGGATACAGG + Intronic
1112131986 13:96534660-96534682 AACAATATACAAGAAGAGGCCGG + Intronic
1112137395 13:96596411-96596433 TGCAATAAACATATGCAGGCAGG + Intronic
1112152888 13:96783339-96783361 CAAACTAAACATCAGGAGGCTGG + Intronic
1112165344 13:96912647-96912669 TACAATAAACATGAGAATGCAGG - Intergenic
1112603959 13:100885301-100885323 TACAATAAAAATTATGGGGCTGG - Intergenic
1112605502 13:100901543-100901565 GACAATATACAGGAGGAGCCTGG - Intergenic
1114285044 14:21233464-21233486 TAAAATAAACATGTGGACACTGG + Intronic
1114360291 14:21964676-21964698 TACAATAAACATGAGGAGGCAGG + Intergenic
1114651112 14:24285044-24285066 TACATTAAACAGGAAGAGGATGG - Intergenic
1115486139 14:33913238-33913260 TGCAATAAACATGGGGGTGCAGG + Intergenic
1116086642 14:40247672-40247694 TGCAATAAACACGAGGTTGCAGG - Intergenic
1117262372 14:54049011-54049033 TATTATAAACACGAGGAAGCTGG - Intergenic
1117272856 14:54162944-54162966 TAGAATAAACATGAGGACTAAGG + Intergenic
1117792549 14:59356379-59356401 TACATTAAAAATAAGGTGGCAGG - Intronic
1118141024 14:63082849-63082871 TGCAATAAACATGGGGTTGCAGG - Intronic
1119507013 14:75181744-75181766 TGCTATACACATGAGTAGGCAGG - Intergenic
1120332839 14:83115490-83115512 TACAATCATCATTTGGAGGCTGG - Intergenic
1120394220 14:83947281-83947303 TGCAGTAAACATGAGGATGCAGG + Intergenic
1120626681 14:86836080-86836102 TGCAATACACATGGGGATGCAGG - Intergenic
1121903740 14:97720471-97720493 TACAATAAACATGGGAGTGCAGG + Intergenic
1121907500 14:97760268-97760290 TTTAATATACATGAGGAGGAGGG + Intronic
1122944552 14:105000938-105000960 TGCAATAAACATGGGGGTGCGGG - Intronic
1123192963 14:106588955-106588977 TAAAAAAAAAATGAAGAGGCTGG + Intergenic
1124833286 15:33170934-33170956 TGCAGTAAACATGAGGGTGCAGG - Intronic
1126610046 15:50519970-50519992 TGCAATAAACATGAGGGTGCAGG - Intronic
1126659501 15:51018464-51018486 TGCAATAAACATGAGGGTGCAGG + Intergenic
1126979210 15:54222542-54222564 TGCAATAAACATGAGAGAGCAGG + Intronic
1126998452 15:54474110-54474132 TACAATAAACACGGGGGTGCAGG + Intronic
1128586165 15:68852410-68852432 TAAAATAAACATGAAGAGAAAGG + Intronic
1128609649 15:69063535-69063557 AAAAAAAAAAATGAGGAGGCGGG + Intergenic
1129012593 15:72435879-72435901 TACATTAACAATGAGGAAGCTGG - Intergenic
1129534318 15:76299576-76299598 TTTAAGAAACATCAGGAGGCAGG - Intronic
1130726396 15:86443903-86443925 TGCAATAAACATAAGGGTGCAGG + Intronic
1131005620 15:88975300-88975322 TGCAATAAATATGAGGGTGCAGG + Intergenic
1131139725 15:89967407-89967429 TACATTAAAAAAGAAGAGGCTGG + Intergenic
1131614968 15:94006434-94006456 TATAATAAACATGTGGTGTCCGG - Intergenic
1131987250 15:98055908-98055930 TACAATAAACATGGGGCTCCAGG + Intergenic
1133559182 16:6934416-6934438 TGCAATAAACATGTAAAGGCAGG - Intronic
1134398556 16:13888056-13888078 TACTATAAACATGAATAGGAAGG - Intergenic
1134753401 16:16645111-16645133 TACAATAAACATGGGTGTGCAGG + Intergenic
1134781607 16:16903075-16903097 TGCAATAAACATGAGGGTGGAGG + Intergenic
1134992657 16:18713970-18713992 TACAATAAACATGGGTGTGCAGG - Intergenic
1137257098 16:46784882-46784904 TACAATAAACATTAGCAAGATGG + Intronic
1138498125 16:57420948-57420970 TGCAATAAACATGGGGGTGCAGG - Intergenic
1138637600 16:58353737-58353759 TGCAATAAACATGAGGGTGCAGG + Intronic
1138739040 16:59286300-59286322 TGCAATAAACATGGGGATGCAGG - Intergenic
1138946531 16:61858025-61858047 AACAATATACTTGGGGAGGCAGG - Intronic
1138953655 16:61944643-61944665 CACAATAAATAGGAGCAGGCGGG + Intronic
1139822627 16:69732392-69732414 TACAATAGAGAGGAGGAGGCCGG - Intergenic
1140000500 16:71020510-71020532 TAGATTAATCATGTGGAGGCCGG + Intronic
1141137980 16:81478908-81478930 TCCAATGAACAAGACGAGGCTGG - Intronic
1141251995 16:82367750-82367772 GAAAATAAACATGAGTTGGCCGG + Intergenic
1144121500 17:12158357-12158379 TGCAATAAACATGAGAGTGCAGG + Intergenic
1145849539 17:28078851-28078873 TACAATAAATCTGAGAAGGGAGG - Intronic
1147116939 17:38307692-38307714 AAGAATCAACATTAGGAGGCTGG + Intronic
1147272247 17:39282515-39282537 AAAAATAAACTTGAGGAGGAGGG - Intronic
1147733916 17:42622098-42622120 TTCAAAAAACAAGTGGAGGCTGG + Intergenic
1149125312 17:53223275-53223297 TACAATAAACATATGGGTGCAGG - Intergenic
1149426854 17:56563533-56563555 TACATTAAACCACAGGAGGCTGG - Intergenic
1150467871 17:65410116-65410138 CACGATAAACATGAGGATGCAGG - Intergenic
1150739814 17:67770176-67770198 AAAAATAAAAAGGAGGAGGCCGG - Intergenic
1150773866 17:68063709-68063731 TAAAATAAAAATGATGGGGCAGG - Intergenic
1152204957 17:78969761-78969783 AACAAAAAACATGTGGAGGAGGG + Intergenic
1153016616 18:588147-588169 TGCAATAAACATGGGGGTGCAGG + Intergenic
1153078148 18:1189726-1189748 TACAATAAACAAGAACAGACAGG - Intergenic
1153262538 18:3238419-3238441 TACAATAAACATGGTGAAGATGG + Intergenic
1153876913 18:9382199-9382221 TAGAAAAAACAAGAGGAGGCTGG + Intronic
1154008511 18:10556108-10556130 GACAATAAACATTAGGATGATGG + Intergenic
1154027235 18:10719649-10719671 TACAATAAACATGTGAGTGCAGG + Intronic
1154944510 18:21148350-21148372 AACAAAAAAATTGAGGAGGCTGG - Intergenic
1156060572 18:33070217-33070239 TGCAATAAACATGCGGGTGCAGG - Intronic
1156960424 18:43021997-43022019 TGCAATAAACATGGGAATGCAGG - Intronic
1156977391 18:43238911-43238933 TAAAATAAAAATGAGAAGGGTGG - Intergenic
1157445222 18:47739881-47739903 TGCAATAAACATGACGTTGCAGG - Intergenic
1157555281 18:48609544-48609566 TACTTTAAACATGAGGAAGCAGG + Intronic
1157821481 18:50774445-50774467 GTCAATAAACATGGGGATGCAGG - Intergenic
1157933501 18:51849003-51849025 AATTATAAACATGAGGAGGGAGG - Intergenic
1157978046 18:52348884-52348906 CACAATAAACAGGATAAGGCAGG - Intronic
1158369865 18:56788335-56788357 GACAATAAAAAAGAGGAGGAAGG - Intronic
1158736036 18:60080964-60080986 TGCAATAAACACAGGGAGGCAGG - Intergenic
1158747781 18:60221188-60221210 TGCAATAAACATGGGAATGCAGG + Intergenic
1158786950 18:60725594-60725616 TACAATAAACATATGCATGCAGG + Intergenic
1159113260 18:64084829-64084851 TACAAGCATCATGAGAAGGCTGG - Intergenic
1159174843 18:64819103-64819125 TACAATAAAGATCAGTAGGAAGG + Intergenic
1161488105 19:4546561-4546583 TAAAATAAAAATAAAGAGGCAGG - Intronic
1162050692 19:8030784-8030806 AAAAAAAAAAATGAGGAGGCAGG + Intronic
1162363520 19:10233642-10233664 TAAAATAAAAATAAAGAGGCTGG + Intergenic
1162774636 19:12971885-12971907 AACAAAAAACATGAAAAGGCCGG - Intronic
1163355541 19:16808145-16808167 TAGCATGAACATGGGGAGGCGGG - Intronic
1164256833 19:23534505-23534527 CACAATAATGATGAGGAGGAAGG + Intronic
1166622732 19:44317110-44317132 TGCAATAAACATGAGATTGCAGG + Intergenic
1167275512 19:48536327-48536349 TAAAATACACGGGAGGAGGCTGG - Intergenic
1168509733 19:56964902-56964924 TAAAATACACATAAGCAGGCCGG + Intergenic
926420503 2:12692101-12692123 TACCAGAAACAGGAAGAGGCAGG - Intergenic
927130782 2:20057610-20057632 TGCAATGAACATGAGGGTGCAGG - Intergenic
927837073 2:26407659-26407681 AACCATAAACATGAGGAGGAGGG - Intronic
929272930 2:39993529-39993551 TGCAATAAACATGGGAGGGCAGG - Intergenic
929910953 2:46089182-46089204 TAGAATAAGAATGAGGAGGGAGG - Intronic
930909350 2:56611980-56612002 TCCAAAAATCATGAAGAGGCTGG - Intergenic
931227458 2:60344346-60344368 AACAATAAACATGAGAAAACTGG + Intergenic
931618153 2:64182447-64182469 TACAATAAACATGTGAATGCCGG - Intergenic
931784008 2:65602883-65602905 TAGATAAAACATGAGGAGGTTGG + Intergenic
932651282 2:73560589-73560611 TGCAATAAACATGAGTATACAGG - Intronic
933175868 2:79172339-79172361 TGCAATAAACATGGGAGGGCAGG - Intergenic
933496973 2:83061970-83061992 TACAATATAAAAGATGAGGCCGG + Intergenic
933771700 2:85748790-85748812 AACAAAAAACAGGAGGAGGCTGG - Intergenic
934487206 2:94726271-94726293 TGCTATAAACATGAGGGTGCAGG + Intergenic
934911325 2:98257410-98257432 TGCAATAAACATGAGGGTGCAGG + Intronic
935545586 2:104396410-104396432 TGCATTAAACATGAGCAGCCAGG - Intergenic
936261657 2:110965274-110965296 TGCAATAAACATGTGGGTGCAGG + Intronic
936603233 2:113920919-113920941 TGCAATAAACATGAGGGTGCAGG + Intronic
936635650 2:114253822-114253844 TACAAAAAATATGAGGATGGAGG + Intergenic
936785464 2:116089197-116089219 TGCAATAAACATAAGGCTGCAGG + Intergenic
936936889 2:117847593-117847615 TACAAGAATCATGATGAGGTAGG - Intergenic
937257276 2:120564468-120564490 TACATTAAACAAGAGGAGGGCGG + Intergenic
937266501 2:120618261-120618283 TAGAAGTAACATGATGAGGCCGG + Intergenic
937772518 2:125736692-125736714 TACAATAAACAAGAACAGACAGG + Intergenic
938263407 2:129910653-129910675 AACAAGAAACCTGGGGAGGCAGG + Intergenic
938693886 2:133817384-133817406 TACAATAAACATGAGGGTGCAGG - Intergenic
938821605 2:134966178-134966200 TGCAATAAGCATGAGGATGCAGG + Intronic
939315722 2:140547188-140547210 TACAAAAAAATTGAGGAGGAGGG - Intronic
939898130 2:147817522-147817544 AAAAATAAACATAAGCAGGCTGG + Intergenic
941050578 2:160728496-160728518 TATAATAAACATGTGCATGCAGG - Intergenic
941497838 2:166229102-166229124 TTTAATAAACATGAGTCGGCTGG - Intronic
943188813 2:184649916-184649938 TACAAAAAATTTGAGGAGGAGGG + Intronic
943309144 2:186305002-186305024 TATACTAAAAATGAGGAGGTAGG - Intergenic
944330479 2:198459995-198460017 TACAATAAACAAAAGAAAGCTGG - Intronic
944704008 2:202270791-202270813 AAAAATGAAAATGAGGAGGCTGG + Intronic
946641752 2:221791249-221791271 TGCAATAAACATGGGGGTGCAGG - Intergenic
947321811 2:228927422-228927444 AACAATAAACATGAGAAATCAGG - Intronic
1169444328 20:5658820-5658842 AACATTAAAAATTAGGAGGCTGG + Intergenic
1169528753 20:6460437-6460459 TACGATAAACATGGGAATGCAGG - Intergenic
1169598052 20:7223286-7223308 TGCAATAAACATGAGGGTGCAGG + Intergenic
1169812495 20:9622474-9622496 TGAAGTAAACATGAGGAGGAGGG + Intronic
1170064625 20:12298367-12298389 CACAAAAAACATGAAAAGGCAGG - Intergenic
1171293990 20:24000698-24000720 TACAATAAAGGTAAGTAGGCTGG + Intergenic
1172949656 20:38714681-38714703 TAGAATAAACATGTGGGGGGCGG + Intergenic
1173936256 20:46867867-46867889 AACAATAAGCATAAGAAGGCAGG - Intergenic
1174979051 20:55371480-55371502 TGCAATAAACATGAGAATGCAGG + Intergenic
1175378381 20:58545184-58545206 TTAAATAAACATGATGTGGCTGG - Intergenic
1175446099 20:59020597-59020619 TACAATAAACATGAGAGGGGAGG - Intronic
1176838005 21:13812161-13812183 TGCTATAAACATGAGGGTGCTGG + Intergenic
1177101841 21:16907627-16907649 TGCAATAAACATGGGGGTGCAGG - Intergenic
1177432125 21:21003550-21003572 AACAATAAATATGTGTAGGCAGG + Intronic
1177512433 21:22106651-22106673 TACAATAAACATGTGAGTGCAGG + Intergenic
1178764357 21:35435323-35435345 TACAGGGAACATGAGGAGGCGGG - Intronic
1178868571 21:36351877-36351899 TGCAATAAACATGAGAGTGCAGG - Intronic
1179946369 21:44680580-44680602 TGCAATAAACATGGGGGTGCAGG - Intronic
1179964894 21:44797418-44797440 CTCAATAAAAATGAGAAGGCCGG + Intronic
1181533437 22:23530079-23530101 TACAAGTACCATGAGGAGGAAGG + Intergenic
1182509977 22:30812148-30812170 AAAAATAAAAATGAGAAGGCTGG - Intronic
1182721413 22:32404110-32404132 TACAATGAACATGGGAGGGCAGG + Intronic
1182848189 22:33448730-33448752 TTCAATAAAGTTGGGGAGGCAGG - Intronic
1185100625 22:48839108-48839130 TACACTAGAGATGAGGAGACAGG + Intronic
1185183411 22:49377661-49377683 TTCAAGACACATGAGGGGGCGGG + Intergenic
951030178 3:17872790-17872812 TACAATAAACATAAGAATGAAGG + Intronic
952244252 3:31568311-31568333 TGCAATAAACATGAGAGTGCAGG + Intronic
952448184 3:33404114-33404136 TAAAATAAATATAATGAGGCCGG + Intronic
952674481 3:36010774-36010796 AACAATAAACATGAGAATGCAGG - Intergenic
952894244 3:38066376-38066398 TACAAGAAAGAGGAGGAGGCAGG - Intronic
954502554 3:51032486-51032508 CACAATAAGCATAAGAAGGCTGG - Intronic
954843196 3:53531146-53531168 TACAAAAATGAGGAGGAGGCTGG - Intronic
955562074 3:60202233-60202255 TACAAGAAAAATGAGGAAGTTGG + Intronic
956543370 3:70370262-70370284 TGCAATAAACATGTGGATGTAGG + Intergenic
956816532 3:72913332-72913354 TAATAAAAACCTGAGGAGGCCGG - Intronic
957262245 3:77917155-77917177 TACAATAAACATGAGAATGCAGG + Intergenic
957487407 3:80880966-80880988 TACGAAAAACAACAGGAGGCTGG - Intergenic
957816882 3:85311670-85311692 TAAAATAAAAATGATGCGGCCGG - Intronic
958575447 3:95944519-95944541 TGCAATAAACATGGGAATGCGGG + Intergenic
958588812 3:96126408-96126430 TGCAATAAACATAAGAAGGCAGG - Intergenic
958686191 3:97399392-97399414 TGCAATAAACATGATGTGGGGGG + Intronic
958918007 3:100071394-100071416 TACAGTTAAGATGGGGAGGCTGG - Intronic
959319385 3:104851505-104851527 TACAATAAAGATGGGAGGGCAGG - Intergenic
959625692 3:108446818-108446840 TATAATAAACATGAAGAATCAGG + Intronic
959722338 3:109506332-109506354 TACAATAAACATGAGAGTGCAGG - Intergenic
959789124 3:110336072-110336094 CACAATAAACATGGGGAGACGGG - Intergenic
959877844 3:111407046-111407068 TACAATAAACAGGGGAATGCAGG + Intronic
959981361 3:112521546-112521568 TACAATAAACATGAAGGTGCAGG + Intergenic
961246993 3:125463098-125463120 TTCAATAAACTTGATGAGGCAGG - Intronic
961265629 3:125640019-125640041 TACAATAAACATGCGAATGCAGG - Intergenic
961675981 3:128567038-128567060 TTCAATAAAAAAGAGGAGGAAGG + Intergenic
962598562 3:136971785-136971807 TGCAATAAACATGAAAAGGGAGG + Intronic
962670620 3:137703404-137703426 AACAATAAACATCAGAAAGCTGG - Intergenic
963005009 3:140718762-140718784 TATTTTAAAGATGAGGAGGCTGG - Intergenic
963246538 3:143068921-143068943 GAAAATAAACTTGGGGAGGCGGG - Intergenic
963687072 3:148449706-148449728 TACAATAAACATATGCATGCAGG - Intergenic
963953041 3:151223382-151223404 TACAATAAACATGTGAATGAAGG - Intronic
964008799 3:151864557-151864579 TACTATAGAGAAGAGGAGGCAGG + Intergenic
964180132 3:153873779-153873801 TGCAACAAACATGGGAAGGCAGG - Intergenic
965976939 3:174636861-174636883 TGCAATAAACATGGGAATGCAGG - Intronic
966632766 3:182096783-182096805 TAAAAGAATCATCAGGAGGCTGG - Intergenic
967006132 3:185384415-185384437 TGCAGTAAACATGGGGATGCAGG + Intronic
967464608 3:189789605-189789627 AACTATAGGCATGAGGAGGCGGG - Intronic
968191836 3:196673948-196673970 TGCAATAAACATGGGAGGGCAGG + Intronic
968256685 3:197280441-197280463 TGCAATAAACATGGGGGTGCAGG + Intronic
970631912 4:17956349-17956371 TGCAGTAAACATGGGGATGCAGG - Intronic
971061479 4:22976842-22976864 TAGAATATACAGGAGGAGGAAGG + Intergenic
971869921 4:32221180-32221202 TATAATACAAATAAGGAGGCCGG - Intergenic
972259952 4:37397651-37397673 TACAATGAACCTGAGAACGCTGG - Intronic
974622573 4:64379852-64379874 TGCAATAATCATGAGGATGCAGG + Intronic
974938892 4:68440111-68440133 TACAATAAAGAAAAGCAGGCTGG - Intergenic
975346733 4:73300258-73300280 TGCAATAAACATGGGAATGCAGG - Intergenic
975920785 4:79384053-79384075 TGCAATAAACATGAGGATATAGG - Intergenic
976073166 4:81265264-81265286 TGCAATAAACATGGGAATGCGGG + Intergenic
976138569 4:81965333-81965355 TGCAATAAACATGGGGGTGCAGG + Intronic
977009448 4:91618274-91618296 TGCAATAAACATGTGGGTGCAGG - Intergenic
977135284 4:93296140-93296162 CACAATAAACTGGAAGAGGCAGG - Intronic
977197251 4:94078553-94078575 CACAAGAAACATGAAAAGGCTGG - Intergenic
977304572 4:95306495-95306517 TATAAAATACATGAAGAGGCAGG - Intronic
978003379 4:103585034-103585056 AACAATAAACATCAGGATGGAGG + Intergenic
978029959 4:103929124-103929146 TACAAAAAAATTGAGGAGGAGGG + Intergenic
978281010 4:107014178-107014200 TACAATAAACATGAGAGTGCAGG - Intronic
978492981 4:109328675-109328697 TACAATAAGCAAGGGGAAGCAGG + Intergenic
978839998 4:113200777-113200799 TGCAATAAACATAAGGGTGCAGG + Intronic
978980088 4:114934031-114934053 TGCAATGAACATGAGAATGCAGG - Intronic
979106803 4:116700128-116700150 CACAAGAAACATGAAGAAGCAGG - Intergenic
979338518 4:119491875-119491897 TGCAATAAACATGGGAATGCAGG + Intergenic
979813375 4:125066657-125066679 TACCATAAACATGGGGGTGCAGG - Intergenic
980737285 4:136906888-136906910 TGCAATAAACATGGTGATGCAGG - Intergenic
980837313 4:138211575-138211597 TGCAATAAACATGAGAAAGCAGG - Intronic
980907449 4:138962265-138962287 TTTAAAAATCATGAGGAGGCCGG + Intergenic
980910353 4:138988446-138988468 AACAATAAACATGTAGATGCTGG - Intergenic
981142578 4:141286637-141286659 TGCAATAAACATGAGGGTGCAGG + Intergenic
982282064 4:153693702-153693724 CACACTAAAGATGAGGAGGAAGG - Intergenic
982367141 4:154591574-154591596 TACAATGAACATGGGAATGCAGG - Intergenic
982989303 4:162250535-162250557 AACAATAAACATGAGAAGGCTGG + Intergenic
983799802 4:171912994-171913016 TGCAATAAACATGTGGGTGCAGG + Intronic
984809768 4:183784940-183784962 TAAATTAAAAATGATGAGGCTGG + Intergenic
984831096 4:183974529-183974551 TACACTAATCATAAGGAAGCTGG + Intronic
984892726 4:184508043-184508065 AAAAATAAAAATGAGTAGGCCGG + Intergenic
985052402 4:186005057-186005079 TGCGATAAACATGGGGATGCAGG + Intergenic
985335697 4:188891351-188891373 TTCAATAAACATGAGGCTGCAGG + Intergenic
986411286 5:7482671-7482693 TACAATAAACATCAAGGTGCAGG - Intronic
986513980 5:8541630-8541652 TACAAAAAAGATGACGAGGCCGG - Intergenic
987357597 5:17078427-17078449 AAAAATAAACCTAAGGAGGCCGG + Intronic
988029301 5:25741271-25741293 TACAATAAACAAGAAGTTGCAGG - Intergenic
988633682 5:32958310-32958332 TACAGTTAAACTGAGGAGGCTGG - Intergenic
990322182 5:54640761-54640783 TAAAAAAAAAATCAGGAGGCTGG + Intergenic
990783157 5:59389639-59389661 TGCAATAAACATGGGGGTGCAGG - Intronic
991077117 5:62553438-62553460 TGTAATAAACATGAGGGAGCAGG + Intronic
991100598 5:62788243-62788265 TACAATCACCAGGAGGAAGCCGG - Intergenic
991533554 5:67641242-67641264 TGCAATAAACATGAGAATGCAGG - Intergenic
991606378 5:68405776-68405798 TACAATCAAAATGAGGGGGATGG - Intergenic
992085483 5:73274732-73274754 AAACATAAACATAAGGAGGCAGG - Intergenic
995535665 5:113133575-113133597 TGCAATAAACAAGAGAATGCAGG + Intronic
996331821 5:122337834-122337856 AAAAATAAACCAGAGGAGGCAGG - Intronic
996890673 5:128415655-128415677 TGCTATAAACATGAGGGTGCAGG + Intronic
997126032 5:131227889-131227911 TACAAAAATCATCCGGAGGCTGG + Intergenic
997764574 5:136487542-136487564 TATAATAGACATGAGGACCCAGG + Intergenic
997774448 5:136588155-136588177 TACAATAAACATGTGAATGCAGG - Intergenic
999578520 5:153007973-153007995 TTCAATAAAAATGAGAAGGGAGG + Intergenic
999858054 5:155616705-155616727 TATAATAAACATGGGGGTGCAGG + Intergenic
1000032481 5:157416144-157416166 TGCAATAAATATGAGAGGGCAGG - Intronic
1000360780 5:160445088-160445110 TGCAATAAACATGGGGATGTAGG - Intergenic
1000826385 5:166050277-166050299 CACAATGAACATGAGAAGGCTGG - Intergenic
1000941336 5:167364635-167364657 TACAATAAAAATAAGAAAGCTGG + Intronic
1002602873 5:180364057-180364079 AACAAAAAGCCTGAGGAGGCTGG - Intergenic
1003239221 6:4328271-4328293 TACAAAAATCATGAGGAAGCAGG + Intergenic
1003373052 6:5547246-5547268 TAAAATAACCATTATGAGGCCGG - Intronic
1003685210 6:8295901-8295923 TACAATAATAATGAGCACGCTGG + Intergenic
1004599667 6:17136152-17136174 TCCAAAAAAAATGAGGAGGAGGG + Intergenic
1004926459 6:20420077-20420099 TACAAGTAAAATAAGGAGGCAGG - Intronic
1005897928 6:30194128-30194150 CACAATAAACATGAGTGTGCAGG - Intronic
1005945580 6:30593006-30593028 TAAATTAAAAATAAGGAGGCCGG + Intronic
1006181328 6:32154942-32154964 TACAATAGACCTGTGGACGCGGG + Intronic
1006980942 6:38147439-38147461 CACAATAAACATGCGAATGCAGG + Intronic
1007543355 6:42670887-42670909 TTAAATAAACTTCAGGAGGCCGG + Intronic
1007615123 6:43175203-43175225 TTCTATAAGCATGAGGGGGCTGG - Intronic
1007901918 6:45421400-45421422 CACAAAAAAAATGAGGAGGGGGG - Intronic
1008239499 6:49091831-49091853 TGCAATAAACATGAGGGTACAGG + Intergenic
1009504954 6:64466292-64466314 TGCAATAAACATGGGGGTGCAGG - Intronic
1009670669 6:66745204-66745226 TGCAATAAACATGGGGGTGCAGG + Intergenic
1010500183 6:76589974-76589996 TACAATAAACGTGAAGAATCAGG - Intergenic
1010638175 6:78285732-78285754 TGCAATAAACATGGGAATGCAGG + Intergenic
1011188590 6:84706306-84706328 TACAAAAGACAGGTGGAGGCTGG + Intronic
1011428990 6:87264999-87265021 TACAATAAACATGCTGAAACAGG - Intergenic
1011636187 6:89375860-89375882 TAAAACAAACATGGGGAGGGAGG - Intronic
1013350170 6:109298403-109298425 TAAAATACAGATGTGGAGGCAGG - Intergenic
1013453903 6:110312392-110312414 TGCAATAAACATGGGGATGCAGG - Intronic
1013917885 6:115364211-115364233 AATAATAAACATGAGAAGACAGG + Intergenic
1014073379 6:117208793-117208815 TGCAATAAACATGAGAGTGCAGG + Intergenic
1014330779 6:120060864-120060886 TGCAATAAACATGTGAGGGCAGG - Intergenic
1014433982 6:121401027-121401049 TACTATAAATATGTGGAGGGTGG + Intergenic
1014862924 6:126492600-126492622 TGCAATAAACATGGGGGTGCCGG + Intergenic
1015594643 6:134854766-134854788 TGCAATAAACATGGGGGTGCAGG + Intergenic
1015885734 6:137916140-137916162 TAAAATAAATAGAAGGAGGCAGG + Intergenic
1016104474 6:140145249-140145271 TACTATAAAAATGGGGAGGAAGG + Intergenic
1016405697 6:143727408-143727430 TACAATAAACATGGGCATGCAGG + Intronic
1017650223 6:156574205-156574227 TGCAATAAACATGGGGGTGCAGG + Intergenic
1018263632 6:161996080-161996102 TACAATAAACATGGGGGTACAGG - Intronic
1018273639 6:162106987-162107009 TTCAATACACATGAGGAGCTCGG + Intronic
1020673115 7:11144406-11144428 TGCAATAAACATGGGGGTGCAGG - Intronic
1020707978 7:11569711-11569733 TGCCATAAACATGGGGATGCAGG - Intronic
1021367406 7:19796855-19796877 TGCAATAAGCATGAGGGTGCAGG + Intergenic
1021629069 7:22625762-22625784 GACAATAAACATGAGCAGGTTGG + Intronic
1021752818 7:23821100-23821122 TGCAATAAACATGGGGATGCAGG + Intronic
1021996599 7:26184079-26184101 TGCAATAAACATGGGGGTGCAGG - Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022624938 7:32025535-32025557 GACAGAAAACCTGAGGAGGCTGG + Intronic
1023210386 7:37797814-37797836 TACAGGAAATATTAGGAGGCAGG - Intronic
1023409508 7:39875462-39875484 TGCAATAAACATGGGGGTGCTGG + Intergenic
1023476223 7:40581213-40581235 TACAATTAACTTGTGGAGGTAGG + Intronic
1023482295 7:40646823-40646845 TTCACTAAACTCGAGGAGGCAGG + Intronic
1023594926 7:41819112-41819134 TGCAATAAACATGGGGATGCAGG + Intergenic
1023724679 7:43130687-43130709 GACAACAAACATCAGCAGGCTGG + Intronic
1024864088 7:53882868-53882890 TAAAATAAACCTAAGGAGGATGG + Intergenic
1025043424 7:55668559-55668581 TGCAATAAACATGGGGGTGCTGG - Intergenic
1025839905 7:65136503-65136525 TTTAAAAAACATGATGAGGCCGG - Intergenic
1025883161 7:65559462-65559484 TTTAAAAAACATGATGAGGCCGG + Intergenic
1025890285 7:65643144-65643166 TTTAAAAAACATGATGAGGCCGG - Intergenic
1028434315 7:90783965-90783987 TGCAATAAACATGGGGGTGCAGG - Intronic
1028627266 7:92891099-92891121 TGCAATAAACCTGGGGATGCAGG - Intergenic
1028990738 7:97046342-97046364 CACTATAACCATGAGAAGGCTGG - Intergenic
1029939271 7:104462774-104462796 GACAAAAAAAATGAGGAGGAGGG - Intronic
1030647055 7:112073331-112073353 GACAGTAAACATGGGGATGCAGG - Intronic
1031518309 7:122729317-122729339 CACAATAAACATGAGGATGCAGG + Intronic
1031604603 7:123753408-123753430 TACATTATAAATGAGTAGGCAGG + Intergenic
1031801100 7:126246925-126246947 TGCAATAAACATGCGGGTGCAGG + Intergenic
1031852194 7:126878864-126878886 TTTAAAAAACATGATGAGGCCGG + Intronic
1032972338 7:137179250-137179272 TACAAAAAACATGGGAGGGCAGG - Intergenic
1033877076 7:145834732-145834754 TGCAATAAACATGAGAGTGCAGG + Intergenic
1034118376 7:148604735-148604757 TAAAATAAACAGAAGAAGGCAGG + Intronic
1034687198 7:152983050-152983072 TGCAATAAACATGGGGGTGCAGG - Intergenic
1034742162 7:153485752-153485774 TGCAATAAACATGAGGGTGCAGG - Intergenic
1035118151 7:156542412-156542434 TGCAATAAACCTGAGAATGCAGG - Intergenic
1035405041 7:158591097-158591119 TAAAATAAACTCCAGGAGGCCGG + Intergenic
1036476329 8:9096596-9096618 TACAATCAACATCAGGCAGCTGG - Intronic
1036478340 8:9115156-9115178 GACAATAAACATAAGAAGACTGG + Intronic
1036656036 8:10678137-10678159 GAAAATAGACATCAGGAGGCTGG + Intronic
1037149179 8:15615151-15615173 TTCAATAAACATGAGAGGACAGG - Intronic
1037280571 8:17237296-17237318 TTTAAAAAACATGAGGAGGAAGG - Exonic
1037981959 8:23260806-23260828 CACTATAAAGATGAGAAGGCAGG - Exonic
1039759260 8:40557177-40557199 TGCAATAAACATGAGAGTGCAGG - Intronic
1041721084 8:60975951-60975973 TACAATAAGTACAAGGAGGCCGG + Intergenic
1041854008 8:62428292-62428314 TTCAATAAACATGAGAGTGCAGG + Intronic
1042161246 8:65897913-65897935 TAAAAAAAAAATAAGGAGGCCGG - Intergenic
1042276630 8:67011972-67011994 TAAAATAAAACTGATGAGGCCGG + Intronic
1043184932 8:77136419-77136441 CACAATAAACATGAGGGTGTAGG + Intergenic
1043283447 8:78499346-78499368 TGCAATAAACATGAGTGTGCAGG - Intergenic
1043348523 8:79329837-79329859 TGCAATAAACATGATGGTGCAGG - Intergenic
1043481859 8:80661484-80661506 TGCAATAAACATGAGAGTGCAGG - Intronic
1044171915 8:89064007-89064029 TGCAATAAACATGGGAATGCAGG + Intergenic
1044876782 8:96676606-96676628 TACAATAAACATGAAAATGTAGG + Intronic
1045900572 8:107274661-107274683 TACCATAAACCTTTGGAGGCAGG + Intronic
1046250266 8:111622341-111622363 TGCAATAAACATGAGAGTGCAGG + Intergenic
1047059702 8:121211035-121211057 TACAATAAACATATGCATGCAGG + Intergenic
1047417505 8:124677164-124677186 TACACAAATCAGGAGGAGGCAGG + Intronic
1047657842 8:126998240-126998262 TGCAATAAACATGACGAAGCGGG - Intergenic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1048905982 8:139089511-139089533 TGCCATAAACATGAGGGTGCAGG + Intergenic
1051274322 9:15384370-15384392 TAGAATTAAAATGATGAGGCCGG + Intergenic
1051925499 9:22320044-22320066 ATCAATAAATATGAGGATGCTGG - Intergenic
1052672067 9:31570926-31570948 TACAGTAAACATGAGGGTGCAGG + Intergenic
1053047414 9:34931401-34931423 TATAATGAACTTGAGGATGCAGG + Intergenic
1053320861 9:37097849-37097871 TAAAAAATACATGTGGAGGCCGG + Intergenic
1053372976 9:37577919-37577941 TGCAATAAACATGGGGATCCAGG - Intronic
1053670596 9:40358080-40358102 TGCTATAAACATGAGGGTGCAGG - Intergenic
1053920384 9:42984424-42984446 TGCTATAAACATGAGGGTGCAGG - Intergenic
1054381718 9:64498143-64498165 TGCTATAAACATGAGGGTGCAGG - Intergenic
1054514017 9:66018220-66018242 TGCTATAAACATGAGGGTGCAGG + Intergenic
1056251546 9:84753517-84753539 TACAATAAACATGGGCTGCCAGG + Intronic
1057155451 9:92834264-92834286 TGCAATAAACATGAGGATGCAGG - Intergenic
1057462098 9:95272237-95272259 CTCAATAAAAAAGAGGAGGCGGG - Intronic
1057477354 9:95414070-95414092 AATCATTAACATGAGGAGGCAGG - Intergenic
1057492601 9:95533257-95533279 TGCAATAAACATGGGGGTGCAGG - Intergenic
1057889577 9:98858995-98859017 TACAATAAACATGGGAGTGCAGG + Intergenic
1058352865 9:104047137-104047159 TGCAATAAACATGAGGATGTAGG - Intergenic
1059066361 9:111089738-111089760 AACAGTAAACATTAGAAGGCTGG + Intergenic
1059815930 9:117915074-117915096 TGCCATAAACATGAAGATGCAGG - Intergenic
1060097999 9:120810855-120810877 TGCAATATACATGAGGGTGCAGG + Intergenic
1060643630 9:125259986-125260008 TGAAATAAGCAAGAGGAGGCCGG - Intergenic
1061864216 9:133484191-133484213 TAAAATTAACATGATGGGGCCGG + Intergenic
1062688021 9:137826289-137826311 AACCAGAAACATGAGGAGACAGG - Intronic
1062714990 9:138005157-138005179 TGCCATGAGCATGAGGAGGCAGG - Intronic
1186360047 X:8831472-8831494 TACAATAAAAATATGGAGTCAGG + Intergenic
1186559440 X:10595241-10595263 TGCAATAAACATGAATATGCGGG - Intronic
1187291142 X:17954386-17954408 TACAATAAACATGGTGTGGTGGG - Intergenic
1187456209 X:19443425-19443447 TACTATAAGCCTGAGGGGGCAGG - Intronic
1188656392 X:32702398-32702420 TAGAATAAACATGCAGAGGTAGG + Intronic
1188717995 X:33484810-33484832 TGCAATAAACATGAGAGTGCAGG - Intergenic
1188939222 X:36216465-36216487 TACAATGTAAATGAGGAGCCAGG - Intergenic
1189108306 X:38259600-38259622 TGCAATAAACATGGGGGTGCAGG + Intronic
1189422934 X:40873040-40873062 CACAATACCCATGTGGAGGCAGG + Intergenic
1189628665 X:42927568-42927590 TGCAATAAACATGAGAGTGCAGG - Intergenic
1190993696 X:55582716-55582738 TACAATTAAAATTAGTAGGCTGG + Intergenic
1191175225 X:57492813-57492835 TTCATTAAACATGAGAATGCAGG - Intergenic
1191219240 X:57969158-57969180 TGCAATAAACATGAGGATGCAGG + Intergenic
1191647700 X:63500597-63500619 TACAATAAGCATGAGAGTGCAGG - Intergenic
1191685986 X:63891669-63891691 TGCAATAAACATGGGGATGCAGG - Intergenic
1193211762 X:78814929-78814951 TGCAATAAACATGAGGTTGCAGG - Intergenic
1193324477 X:80163657-80163679 TACAGTAAACATGGGGGTGCAGG - Intergenic
1193889355 X:87025232-87025254 TGCAATAAACATAAGAATGCAGG + Intergenic
1193970499 X:88045451-88045473 TGCAATAAACATGAGGGTGCAGG - Intergenic
1194178631 X:90685593-90685615 TGCAATAAACATGAGATTGCAGG + Intergenic
1194261776 X:91704314-91704336 TGCAATAAACATGTGTATGCAGG - Intergenic
1194567088 X:95503203-95503225 TGCAATAAACATGAGAATGCAGG + Intergenic
1194689024 X:96959043-96959065 TGCAATAAACATGAGGGTGCAGG + Intronic
1194837818 X:98702872-98702894 TGCAATAAACATGGAGATGCAGG + Intergenic
1195058043 X:101165749-101165771 TAGAAGAAAAATCAGGAGGCTGG + Intergenic
1196238223 X:113307832-113307854 TACAATAAACATGGGAGTGCAGG - Intergenic
1196793518 X:119484724-119484746 TGCAATAAACATGGGGAGGCAGG + Intergenic
1198860448 X:141063447-141063469 TGCAATAAACATGAGAATGCAGG - Intergenic
1198902242 X:141523943-141523965 TGCAATAAACATGAGAATGCAGG + Intergenic
1199075779 X:143523863-143523885 TGCAACAAACATGAGAATGCAGG + Intergenic
1200525295 Y:4267755-4267777 TGCAATAAACATGAGATTGCAGG + Intergenic
1200580426 Y:4943105-4943127 TGCAATAAACATGTGTATGCAGG - Intergenic
1200958283 Y:8972645-8972667 TTCAGAAATCATGAGGAGGCTGG - Intergenic