ID: 1114362159

View in Genome Browser
Species Human (GRCh38)
Location 14:21985924-21985946
Sequence CCTCTTAAGCAGTAGAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114362155_1114362159 21 Left 1114362155 14:21985880-21985902 CCATCATACACTTTAAACTTTCC No data
Right 1114362159 14:21985924-21985946 CCTCTTAAGCAGTAGAAGGCTGG No data
1114362156_1114362159 0 Left 1114362156 14:21985901-21985923 CCTTGATATTTCTTTTAGCTGTG No data
Right 1114362159 14:21985924-21985946 CCTCTTAAGCAGTAGAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114362159 Original CRISPR CCTCTTAAGCAGTAGAAGGC TGG Intergenic
No off target data available for this crispr