ID: 1114362278

View in Genome Browser
Species Human (GRCh38)
Location 14:21987785-21987807
Sequence TGTAAGCTAGATCTTGTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114362278_1114362280 22 Left 1114362278 14:21987785-21987807 CCTAGCACAAGATCTAGCTTACA No data
Right 1114362280 14:21987830-21987852 AGACTTACTTTGAAATAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114362278 Original CRISPR TGTAAGCTAGATCTTGTGCT AGG (reversed) Intergenic
No off target data available for this crispr