ID: 1114363262

View in Genome Browser
Species Human (GRCh38)
Location 14:21999524-21999546
Sequence TGGAAGGTGTATAAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114363262_1114363269 19 Left 1114363262 14:21999524-21999546 CCTTCCACTTTATACACCTTCCA No data
Right 1114363269 14:21999566-21999588 TCAAGGGCACATGTACATGCTGG No data
1114363262_1114363267 2 Left 1114363262 14:21999524-21999546 CCTTCCACTTTATACACCTTCCA No data
Right 1114363267 14:21999549-21999571 CTGAAAGAAGGAGAAAGTCAAGG No data
1114363262_1114363268 3 Left 1114363262 14:21999524-21999546 CCTTCCACTTTATACACCTTCCA No data
Right 1114363268 14:21999550-21999572 TGAAAGAAGGAGAAAGTCAAGGG No data
1114363262_1114363264 -10 Left 1114363262 14:21999524-21999546 CCTTCCACTTTATACACCTTCCA No data
Right 1114363264 14:21999537-21999559 ACACCTTCCAGACTGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114363262 Original CRISPR TGGAAGGTGTATAAAGTGGA AGG (reversed) Intergenic
No off target data available for this crispr