ID: 1114364684

View in Genome Browser
Species Human (GRCh38)
Location 14:22013631-22013653
Sequence CTATTCCAGTATAAGATTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114364681_1114364684 -4 Left 1114364681 14:22013612-22013634 CCCACACACCAGGGAGAGACTAT 0: 1
1: 0
2: 0
3: 12
4: 151
Right 1114364684 14:22013631-22013653 CTATTCCAGTATAAGATTTGTGG 0: 1
1: 0
2: 1
3: 15
4: 142
1114364682_1114364684 -5 Left 1114364682 14:22013613-22013635 CCACACACCAGGGAGAGACTATT 0: 1
1: 0
2: 1
3: 7
4: 130
Right 1114364684 14:22013631-22013653 CTATTCCAGTATAAGATTTGTGG 0: 1
1: 0
2: 1
3: 15
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114364684 Original CRISPR CTATTCCAGTATAAGATTTG TGG Intergenic
903695252 1:25201548-25201570 ATATTTCAGTGTGAGATTTGGGG - Intergenic
904229582 1:29056828-29056850 CTACTTCAGTTTAAGAATTGAGG - Intronic
905931360 1:41790128-41790150 CAATTTCAGCATGAGATTTGGGG - Intronic
906473649 1:46151982-46152004 CTGTTCCAGGATAAGACTTTGGG - Intronic
908481301 1:64542589-64542611 ATATTCAATTTTAAGATTTGTGG + Intronic
910017832 1:82549262-82549284 CTATTCCTGTATGTGATTAGTGG + Intergenic
910255208 1:85241187-85241209 ATATTTCAATATGAGATTTGGGG - Intergenic
910354162 1:86335892-86335914 ATATTTCAGTATATGATTTTGGG - Intergenic
910441036 1:87252292-87252314 CAATTCCAATATAAGATGTAAGG - Intergenic
910506449 1:87954763-87954785 CTTTTGCAGTGTCAGATTTGTGG + Intergenic
913402013 1:118446517-118446539 CTATTCAAATATAATATTTTGGG - Intergenic
920273911 1:204789754-204789776 CTATTCAAGTAGTAGATTTAAGG + Intergenic
921612612 1:217230308-217230330 CTATTTCAGGAAAATATTTGAGG - Intergenic
922243725 1:223774733-223774755 CTTTTCCAGTACAAGTTTTTTGG + Intronic
922723496 1:227910809-227910831 CTCTTCCAGTCAACGATTTGAGG - Intergenic
924513659 1:244748972-244748994 CTATTTCAATATATGAATTGGGG - Intergenic
1074284494 10:112085319-112085341 CCACTCCAGTAGAAGATTGGAGG + Intergenic
1078696231 11:13635034-13635056 CTATTCTAGTTTCAGATTAGGGG - Intergenic
1079524241 11:21365196-21365218 CTATTCCACTATGAGATTCTTGG + Intronic
1081830342 11:46105885-46105907 CTATTGCAGTATAAGTTATTGGG + Intronic
1082696400 11:56370457-56370479 CTGTTCCAATATAATATTTATGG + Intergenic
1082831216 11:57618935-57618957 CTTTTCCAGTATACCATATGTGG + Intergenic
1088543635 11:110938361-110938383 CTATTTAAGGATAATATTTGTGG - Intergenic
1089044957 11:115492767-115492789 CAATTCCAGTCTAACATCTGAGG - Intronic
1089268496 11:117284428-117284450 AAATTCCTGAATAAGATTTGAGG + Intronic
1089943504 11:122443511-122443533 CTATCCCAGGCTAATATTTGAGG - Intergenic
1090607269 11:128434094-128434116 CTATACCAGTATGAGAATTATGG + Intergenic
1091105385 11:132914404-132914426 CTGTTCCAATATAATATTTATGG + Intronic
1092050006 12:5461850-5461872 CTATTCCAAAATAAGAGTCGTGG - Intronic
1093909344 12:24727785-24727807 CTACTCTAGTGTAAGATTTTTGG + Intergenic
1095584828 12:43837973-43837995 AGATTCCAGGATAATATTTGTGG - Intronic
1096494029 12:52028996-52029018 CTATTCCACTAAAGGATTTGGGG - Intronic
1097902011 12:64882657-64882679 CTATGCCACTATATGATTTGGGG + Intergenic
1098149570 12:67532427-67532449 CTTTTTCAGTATGATATTTGGGG - Intergenic
1098571596 12:71993695-71993717 CTTTTCCAGTAGATGATTTATGG - Intronic
1099433037 12:82610865-82610887 TTATTCCAGGTTAAGAATTGTGG - Intergenic
1100067642 12:90669498-90669520 ATATTTCAATATGAGATTTGGGG - Intergenic
1103668401 12:122590979-122591001 CTACACCAAAATAAGATTTGAGG - Intronic
1108479284 13:50851773-50851795 CTATGCCATTAAAAAATTTGTGG - Intergenic
1109313661 13:60724734-60724756 CTATTCCAGAATAAGGCTTGTGG - Intergenic
1110451728 13:75644235-75644257 ATAGTCCATTATAAGATATGTGG - Intronic
1111687909 13:91524194-91524216 CTAATGCAGTATAAGACTTCTGG - Intronic
1114364684 14:22013631-22013653 CTATTCCAGTATAAGATTTGTGG + Intergenic
1115151761 14:30293969-30293991 TTATTTCAGCATAAAATTTGGGG - Intergenic
1117222318 14:53618413-53618435 GAATTACAGTATAAGATTTTTGG - Intergenic
1120185056 14:81385760-81385782 TTATTCCAGAATATGGTTTGAGG - Intronic
1202847152 14_GL000009v2_random:188912-188934 CTATTTCAGTGCAATATTTGTGG - Intergenic
1202916615 14_GL000194v1_random:179474-179496 CTATTTCAGTGCAATATTTGTGG - Intergenic
1202876160 14_KI270722v1_random:3587-3609 CTATTTCAGTGCAATATTTGTGG + Intergenic
1125818027 15:42603062-42603084 CTTTTCCAGGATAAAGTTTGAGG + Intronic
1126459651 15:48901420-48901442 CTATGTCAGTATAAGAATTATGG + Intronic
1130003653 15:80070850-80070872 GAATTACAGCATAAGATTTGAGG - Intronic
1130208440 15:81900498-81900520 CTTTTTCAGAATAAGACTTGAGG + Intergenic
1131850695 15:96540604-96540626 CTTTTCCAGTAGAAGAGATGCGG - Intergenic
1135167968 16:20157181-20157203 CCATTCCAATGTAAGATCTGTGG + Intergenic
1139128069 16:64106198-64106220 ACATTCCAGCATCAGATTTGGGG - Intergenic
1144664626 17:17093681-17093703 CTCTTTTAGTATAAGCTTTGTGG - Intronic
1146442203 17:32907111-32907133 CTCTTTGAGTATAAGAATTGTGG + Intergenic
1146798474 17:35799703-35799725 AGTTTCCATTATAAGATTTGTGG - Intronic
1151217675 17:72588923-72588945 TTCTTCCAGGAGAAGATTTGGGG - Intergenic
1158971343 18:62669757-62669779 CTTTTTCTGTATAAGAATTGGGG + Intergenic
1159591459 18:70339510-70339532 CTATGTCAGTATAAGCTTAGGGG + Intronic
1160391203 18:78534736-78534758 ATATTCCAGAACAAGATTTCTGG + Intergenic
1164102395 19:22068727-22068749 CTACTCCAGTATCACATTTTAGG - Intronic
1202674500 1_KI270710v1_random:29226-29248 CTATTTCAGTGCAATATTTGTGG - Intergenic
926899609 2:17736262-17736284 CTTTTCCAGTACAAAATTGGGGG - Intronic
927041611 2:19236315-19236337 ATATTCTAGAATAATATTTGAGG + Intergenic
929024754 2:37589223-37589245 CTATACCTGTATAAGATAGGAGG + Intergenic
929129022 2:38547887-38547909 CTATAGCTGTATAAGTTTTGAGG + Intergenic
930390255 2:50751876-50751898 CTATTCCAGAAAACTATTTGAGG + Intronic
932878789 2:75480215-75480237 CTATTAAAGTATAAGATTTGGGG + Intronic
933288206 2:80407105-80407127 CTTTTCTAATATAAGCTTTGAGG - Intronic
933998793 2:87689196-87689218 CCATTTCAATATGAGATTTGGGG + Intergenic
935526103 2:104169659-104169681 CTATTCCAGTATATGAACAGTGG + Intergenic
936295056 2:111261682-111261704 CCATTTCAATATGAGATTTGGGG - Intergenic
936841230 2:116771955-116771977 CAATTTCAGTGTAAGTTTTGAGG + Intergenic
938051429 2:128176104-128176126 CTATTCCAGTTAAAGAGTAGTGG + Intronic
938974615 2:136464014-136464036 CTATTTCAGTAGAGAATTTGAGG + Intergenic
940384411 2:153053518-153053540 CAATTCCAGCATAAAATTTGGGG - Intergenic
941711530 2:168719225-168719247 ATATTCCAGTTTATAATTTGGGG + Intronic
943404711 2:187465793-187465815 CAATTCCAGTGTCAGATTTGAGG + Exonic
946672771 2:222123978-222124000 CCATTCCAGTGTAAAATGTGTGG - Intergenic
947088621 2:226484567-226484589 CTTTTCTAATATAAAATTTGGGG - Intergenic
948159578 2:235813070-235813092 CAATGACAGTATGAGATTTGAGG - Intronic
1169887874 20:10421570-10421592 CAATTGCAGTAAAAGATTTCTGG + Intronic
1170491182 20:16876530-16876552 ATATTCCAGTAAAAGATGTAGGG + Intergenic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1175584287 20:60125739-60125761 CTGTTTCAGGATAAGATCTGCGG - Intergenic
1176635970 21:9194121-9194143 CTATTTCAGTGCAATATTTGTGG - Intergenic
1176637438 21:9260960-9260982 CTATTTCAGTGCAATATTTGTGG + Intergenic
1180421475 22:12868457-12868479 CTATTTCAGTGCAATATTTGTGG + Intergenic
949158937 3:858159-858181 CTGTTCTAGTGTAAGGTTTGTGG - Intergenic
950587276 3:13903577-13903599 CTATTTCAGCACAAGATTTTTGG - Intergenic
952037488 3:29220494-29220516 CTATTTCAATATGTGATTTGGGG + Intergenic
952892179 3:38050688-38050710 AAATTTCAGTATAAGATTTGAGG + Intronic
955819399 3:62880224-62880246 CTTTTCCAAAATAACATTTGTGG + Intergenic
956573618 3:70726124-70726146 CTATTCCAGTATTCCATTTGAGG + Intergenic
957935236 3:86934007-86934029 CCAATCCGGTATAAGATTTGAGG + Intergenic
958445152 3:94205968-94205990 CTCTTTCATTCTAAGATTTGAGG - Intergenic
959178396 3:102947418-102947440 CTATTCAAGTGAAAGATTTCTGG - Intergenic
959855193 3:111146095-111146117 CTCTTTCAGTATAATACTTGTGG + Intronic
964787464 3:160413896-160413918 CTATCCCTCTATCAGATTTGTGG - Intronic
965658925 3:171020352-171020374 CTAATCCAGTAGAAGATCTGGGG - Intronic
966254600 3:177903438-177903460 CTATTAATGTTTAAGATTTGTGG - Intergenic
966665249 3:182464533-182464555 CTAGTCCAGGAGAAGATCTGTGG + Intergenic
1202749457 3_GL000221v1_random:144060-144082 CTATTTCAGTGCAATATTTGTGG - Intergenic
972081115 4:35151175-35151197 GTATTCAAGTATAAAATTTTTGG - Intergenic
975244788 4:72107443-72107465 CTTTTCCAGTATTAGTTATGGGG + Intronic
975742837 4:77446965-77446987 CTATTACATTCTTAGATTTGTGG - Intergenic
975771633 4:77730102-77730124 CTATTGGAATATAAGCTTTGGGG + Intronic
975879733 4:78890034-78890056 CTATTACAGTATCAAAGTTGAGG - Intronic
976692590 4:87884543-87884565 CTTTACCAGAATAAGATTTGTGG - Intergenic
979127932 4:117000287-117000309 CTATTAAAGTTTTAGATTTGGGG - Intergenic
980610586 4:135156019-135156041 CTAGTCCATTATCAGATGTGTGG - Intergenic
982114229 4:152083771-152083793 CTATTCCAGTGTAAGTTATTAGG - Intergenic
983698226 4:170559274-170559296 ATATTTCAACATAAGATTTGGGG - Intergenic
984005774 4:174305840-174305862 CTATTTCAGTATGAGAGTTGAGG + Intronic
984642324 4:182181346-182181368 CTCTTTCAGCAGAAGATTTGGGG - Intronic
1202752331 4_GL000008v2_random:19376-19398 CTATTTCAGTGCAATATTTGTGG + Intergenic
987003510 5:13686069-13686091 CTACTTAAGTATAAAATTTGTGG + Intergenic
987543096 5:19280044-19280066 ATTTACCAGTATATGATTTGGGG + Intergenic
990532025 5:56683679-56683701 AGATTCCAGTATAAGAATTTTGG - Intergenic
990845189 5:60129756-60129778 CTATTGAAGTATAAGATCTTAGG + Intronic
991721171 5:69494915-69494937 ATATTCCAGAACCAGATTTGGGG + Intronic
995181908 5:109237482-109237504 ATAATTCAATATAAGATTTGGGG - Intergenic
999920419 5:156312641-156312663 CTATTCCACTATGTGATTTGGGG + Intronic
1005407026 6:25500246-25500268 CTATTCCAGTATACAATCTAAGG - Intronic
1009493592 6:64323608-64323630 CTACTTCAGTATAAATTTTGAGG + Intronic
1010376048 6:75171735-75171757 CTATTCCTGTATATGGTATGTGG + Intronic
1010665557 6:78625902-78625924 CTGTTCCAGGGTAAGATTTGAGG - Intergenic
1012832100 6:104216969-104216991 TTACTTCAGTGTAAGATTTGAGG - Intergenic
1012905326 6:105057809-105057831 TTATTTCAGTATAAGAATAGGGG + Intronic
1012942849 6:105434375-105434397 ATATTCTAGAATAAGATTTAAGG + Intergenic
1014051242 6:116957651-116957673 GTACTATAGTATAAGATTTGTGG + Intergenic
1014573116 6:123036066-123036088 CAATTCCATTGTAAAATTTGAGG + Intronic
1016836607 6:148483415-148483437 CAATTTCAGTATAAGGTTTGGGG + Intronic
1024126335 7:46300585-46300607 CTAATCCATTGTAAGATATGTGG - Intergenic
1027579865 7:79978843-79978865 CAATTCCTGTATAAGACCTGAGG - Intergenic
1028511441 7:91629310-91629332 AGATTCCAGTATTAAATTTGGGG + Intergenic
1030551902 7:110972125-110972147 CTATTCCAGTCTACAATTGGGGG - Intronic
1032937547 7:136750396-136750418 CTATTTCAGGATAACATTTATGG + Intergenic
1033904719 7:146188279-146188301 CTTTTCCAGTATAGCATTTTTGG + Intronic
1035430632 7:158817915-158817937 GTACTCCAGTATAATATTTATGG + Intronic
1036093155 8:5691337-5691359 CTCTTCCAGAATAAGATTTTGGG - Intergenic
1036179549 8:6572226-6572248 CTATTCTAGTAAAATATTTACGG + Intronic
1037167753 8:15851736-15851758 GCATTCCAGTATAAGCTTTCTGG + Intergenic
1041481546 8:58326440-58326462 CTGTTCCAGTATAGCATTTAAGG - Intergenic
1044332440 8:90937130-90937152 TTATTCCAGGAGAGGATTTGAGG - Intronic
1044703246 8:94983587-94983609 TAATACCAGTACAAGATTTGGGG - Intronic
1046350974 8:113011727-113011749 TCATGCCAGTATAAGATTTAAGG - Intronic
1055968238 9:81886264-81886286 GGATACCAGTTTAAGATTTGTGG + Intergenic
1058499528 9:105597056-105597078 CTATTCCTTTATAAGATGAGGGG + Intronic
1203718098 Un_KI270742v1:174151-174173 CTATTTCAGTGCAATATTTGTGG - Intergenic
1203652323 Un_KI270751v1:137700-137722 CTATTTCAGTGCAATATTTGTGG - Intergenic
1186940163 X:14497883-14497905 CTATTCCAGGATGATATTTCTGG - Intergenic
1190313772 X:49136164-49136186 CTATTCAACTTCAAGATTTGTGG - Intergenic
1194007185 X:88509112-88509134 CTATTCCAGTGTAGGATATTTGG + Intergenic
1194896225 X:99443921-99443943 TTATTCCATTATAGGATATGTGG - Intergenic
1201172256 Y:11279000-11279022 CTATTTCAGTGCAATATTTGTGG - Intergenic