ID: 1114374786

View in Genome Browser
Species Human (GRCh38)
Location 14:22132638-22132660
Sequence ACAAGGAACATTGTTCCAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114374780_1114374786 -5 Left 1114374780 14:22132620-22132642 CCCTGCTCCCGTCTCCATACAAG No data
Right 1114374786 14:22132638-22132660 ACAAGGAACATTGTTCCAATCGG No data
1114374781_1114374786 -6 Left 1114374781 14:22132621-22132643 CCTGCTCCCGTCTCCATACAAGG No data
Right 1114374786 14:22132638-22132660 ACAAGGAACATTGTTCCAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114374786 Original CRISPR ACAAGGAACATTGTTCCAAT CGG Intergenic
No off target data available for this crispr