ID: 1114374788

View in Genome Browser
Species Human (GRCh38)
Location 14:22132669-22132691
Sequence TAGAGACTCTGTCTCATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114374784_1114374788 18 Left 1114374784 14:22132628-22132650 CCGTCTCCATACAAGGAACATTG No data
Right 1114374788 14:22132669-22132691 TAGAGACTCTGTCTCATTACAGG No data
1114374787_1114374788 -7 Left 1114374787 14:22132653-22132675 CCAATCGGAATCTAAATAGAGAC No data
Right 1114374788 14:22132669-22132691 TAGAGACTCTGTCTCATTACAGG No data
1114374783_1114374788 19 Left 1114374783 14:22132627-22132649 CCCGTCTCCATACAAGGAACATT No data
Right 1114374788 14:22132669-22132691 TAGAGACTCTGTCTCATTACAGG No data
1114374780_1114374788 26 Left 1114374780 14:22132620-22132642 CCCTGCTCCCGTCTCCATACAAG No data
Right 1114374788 14:22132669-22132691 TAGAGACTCTGTCTCATTACAGG No data
1114374785_1114374788 12 Left 1114374785 14:22132634-22132656 CCATACAAGGAACATTGTTCCAA No data
Right 1114374788 14:22132669-22132691 TAGAGACTCTGTCTCATTACAGG No data
1114374781_1114374788 25 Left 1114374781 14:22132621-22132643 CCTGCTCCCGTCTCCATACAAGG No data
Right 1114374788 14:22132669-22132691 TAGAGACTCTGTCTCATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114374788 Original CRISPR TAGAGACTCTGTCTCATTAC AGG Intergenic
No off target data available for this crispr