ID: 1114374794

View in Genome Browser
Species Human (GRCh38)
Location 14:22132746-22132768
Sequence ATCAAGCTGGGTCACCGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114374794_1114374800 11 Left 1114374794 14:22132746-22132768 CCCAGTCGGTGACCCAGCTTGAT No data
Right 1114374800 14:22132780-22132802 TGTCTCTGAAGAAGCCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114374794 Original CRISPR ATCAAGCTGGGTCACCGACT GGG (reversed) Intergenic
No off target data available for this crispr