ID: 1114374888

View in Genome Browser
Species Human (GRCh38)
Location 14:22133660-22133682
Sequence TGTTCTGTAGGAGGACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114374888_1114374892 20 Left 1114374888 14:22133660-22133682 CCTGCTTGTCCTCCTACAGAACA No data
Right 1114374892 14:22133703-22133725 GAGATCTTTCAAATATAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114374888 Original CRISPR TGTTCTGTAGGAGGACAAGC AGG (reversed) Intergenic
No off target data available for this crispr