ID: 1114376407

View in Genome Browser
Species Human (GRCh38)
Location 14:22151368-22151390
Sequence CTCAATTTACCTGGTAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114376407_1114376410 25 Left 1114376407 14:22151368-22151390 CCTCAATTACCAGGTAAATTGAG No data
Right 1114376410 14:22151416-22151438 CTGTCAAGTCCTCTTTCTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114376407 Original CRISPR CTCAATTTACCTGGTAATTG AGG (reversed) Intergenic
No off target data available for this crispr