ID: 1114376410

View in Genome Browser
Species Human (GRCh38)
Location 14:22151416-22151438
Sequence CTGTCAAGTCCTCTTTCTTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114376407_1114376410 25 Left 1114376407 14:22151368-22151390 CCTCAATTACCAGGTAAATTGAG No data
Right 1114376410 14:22151416-22151438 CTGTCAAGTCCTCTTTCTTGCGG No data
1114376409_1114376410 16 Left 1114376409 14:22151377-22151399 CCAGGTAAATTGAGGATGAACTA No data
Right 1114376410 14:22151416-22151438 CTGTCAAGTCCTCTTTCTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114376410 Original CRISPR CTGTCAAGTCCTCTTTCTTG CGG Intergenic
No off target data available for this crispr