ID: 1114383519

View in Genome Browser
Species Human (GRCh38)
Location 14:22233166-22233188
Sequence CAAAATGCTGATAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114383519_1114383522 7 Left 1114383519 14:22233166-22233188 CCCATATCACTATCAGCATTTTG No data
Right 1114383522 14:22233196-22233218 TCATTTAACCAGTCTCTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114383519 Original CRISPR CAAAATGCTGATAGTGATAT GGG (reversed) Intergenic