ID: 1114392226

View in Genome Browser
Species Human (GRCh38)
Location 14:22322368-22322390
Sequence AAGAAGAAGGAGAAAGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114392220_1114392226 13 Left 1114392220 14:22322332-22322354 CCCAAAGACAAATACTAGAGAGA No data
Right 1114392226 14:22322368-22322390 AAGAAGAAGGAGAAAGAGAAAGG No data
1114392221_1114392226 12 Left 1114392221 14:22322333-22322355 CCAAAGACAAATACTAGAGAGAA No data
Right 1114392226 14:22322368-22322390 AAGAAGAAGGAGAAAGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114392226 Original CRISPR AAGAAGAAGGAGAAAGAGAA AGG Intergenic
No off target data available for this crispr