ID: 1114393872

View in Genome Browser
Species Human (GRCh38)
Location 14:22339048-22339070
Sequence CTGGCTTCTGGGTGTTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114393872_1114393878 0 Left 1114393872 14:22339048-22339070 CCAACAAAACACCCAGAAGCCAG No data
Right 1114393878 14:22339071-22339093 TCAAAAATGGCCCAGGCTGCAGG No data
1114393872_1114393876 -7 Left 1114393872 14:22339048-22339070 CCAACAAAACACCCAGAAGCCAG No data
Right 1114393876 14:22339064-22339086 AAGCCAGTCAAAAATGGCCCAGG No data
1114393872_1114393882 29 Left 1114393872 14:22339048-22339070 CCAACAAAACACCCAGAAGCCAG No data
Right 1114393882 14:22339100-22339122 GAAAGACCTGAAAACACACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114393872 Original CRISPR CTGGCTTCTGGGTGTTTTGT TGG (reversed) Intergenic
No off target data available for this crispr