ID: 1114396065

View in Genome Browser
Species Human (GRCh38)
Location 14:22362924-22362946
Sequence ATGCCCAAGTTTCCTTTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114396063_1114396065 -5 Left 1114396063 14:22362906-22362928 CCTCCAATCACTGGGGTCATGCC No data
Right 1114396065 14:22362924-22362946 ATGCCCAAGTTTCCTTTGTTAGG No data
1114396060_1114396065 -2 Left 1114396060 14:22362903-22362925 CCCCCTCCAATCACTGGGGTCAT No data
Right 1114396065 14:22362924-22362946 ATGCCCAAGTTTCCTTTGTTAGG No data
1114396062_1114396065 -4 Left 1114396062 14:22362905-22362927 CCCTCCAATCACTGGGGTCATGC No data
Right 1114396065 14:22362924-22362946 ATGCCCAAGTTTCCTTTGTTAGG No data
1114396056_1114396065 9 Left 1114396056 14:22362892-22362914 CCTTGGAGGAGCCCCCTCCAATC No data
Right 1114396065 14:22362924-22362946 ATGCCCAAGTTTCCTTTGTTAGG No data
1114396061_1114396065 -3 Left 1114396061 14:22362904-22362926 CCCCTCCAATCACTGGGGTCATG No data
Right 1114396065 14:22362924-22362946 ATGCCCAAGTTTCCTTTGTTAGG No data
1114396052_1114396065 26 Left 1114396052 14:22362875-22362897 CCAGGTTCACTCCTGGGCCTTGG No data
Right 1114396065 14:22362924-22362946 ATGCCCAAGTTTCCTTTGTTAGG No data
1114396064_1114396065 -8 Left 1114396064 14:22362909-22362931 CCAATCACTGGGGTCATGCCCAA No data
Right 1114396065 14:22362924-22362946 ATGCCCAAGTTTCCTTTGTTAGG No data
1114396055_1114396065 15 Left 1114396055 14:22362886-22362908 CCTGGGCCTTGGAGGAGCCCCCT 0: 2
1: 15
2: 45
3: 95
4: 417
Right 1114396065 14:22362924-22362946 ATGCCCAAGTTTCCTTTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114396065 Original CRISPR ATGCCCAAGTTTCCTTTGTT AGG Intergenic
No off target data available for this crispr