ID: 1114396757

View in Genome Browser
Species Human (GRCh38)
Location 14:22370641-22370663
Sequence ACCACATGGATCCTCTACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114396757_1114396760 13 Left 1114396757 14:22370641-22370663 CCAGTGTAGAGGATCCATGTGGT No data
Right 1114396760 14:22370677-22370699 AAGAGGCAATCAATTTCCTGTGG No data
1114396757_1114396759 -4 Left 1114396757 14:22370641-22370663 CCAGTGTAGAGGATCCATGTGGT No data
Right 1114396759 14:22370660-22370682 TGGTGTGTTGTGAAATGAAGAGG No data
1114396757_1114396761 24 Left 1114396757 14:22370641-22370663 CCAGTGTAGAGGATCCATGTGGT No data
Right 1114396761 14:22370688-22370710 AATTTCCTGTGGAATAGAATAGG No data
1114396757_1114396764 30 Left 1114396757 14:22370641-22370663 CCAGTGTAGAGGATCCATGTGGT No data
Right 1114396764 14:22370694-22370716 CTGTGGAATAGAATAGGCCAGGG No data
1114396757_1114396763 29 Left 1114396757 14:22370641-22370663 CCAGTGTAGAGGATCCATGTGGT No data
Right 1114396763 14:22370693-22370715 CCTGTGGAATAGAATAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114396757 Original CRISPR ACCACATGGATCCTCTACAC TGG (reversed) Intergenic