ID: 1114398144

View in Genome Browser
Species Human (GRCh38)
Location 14:22385258-22385280
Sequence GTCCATAGTAGGCATTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114398144_1114398154 29 Left 1114398144 14:22385258-22385280 CCTGGGCAATGCCTACTATGGAC No data
Right 1114398154 14:22385310-22385332 AGTAGGCCCAAGGGAGAGGAGGG No data
1114398144_1114398149 12 Left 1114398144 14:22385258-22385280 CCTGGGCAATGCCTACTATGGAC No data
Right 1114398149 14:22385293-22385315 TGGTTTGCTAAGAAAAAAGTAGG No data
1114398144_1114398151 20 Left 1114398144 14:22385258-22385280 CCTGGGCAATGCCTACTATGGAC No data
Right 1114398151 14:22385301-22385323 TAAGAAAAAAGTAGGCCCAAGGG No data
1114398144_1114398146 -8 Left 1114398144 14:22385258-22385280 CCTGGGCAATGCCTACTATGGAC No data
Right 1114398146 14:22385273-22385295 CTATGGACCCTTATTTCTTGTGG No data
1114398144_1114398153 28 Left 1114398144 14:22385258-22385280 CCTGGGCAATGCCTACTATGGAC No data
Right 1114398153 14:22385309-22385331 AAGTAGGCCCAAGGGAGAGGAGG No data
1114398144_1114398150 19 Left 1114398144 14:22385258-22385280 CCTGGGCAATGCCTACTATGGAC No data
Right 1114398150 14:22385300-22385322 CTAAGAAAAAAGTAGGCCCAAGG No data
1114398144_1114398155 30 Left 1114398144 14:22385258-22385280 CCTGGGCAATGCCTACTATGGAC No data
Right 1114398155 14:22385311-22385333 GTAGGCCCAAGGGAGAGGAGGGG No data
1114398144_1114398152 25 Left 1114398144 14:22385258-22385280 CCTGGGCAATGCCTACTATGGAC No data
Right 1114398152 14:22385306-22385328 AAAAAGTAGGCCCAAGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114398144 Original CRISPR GTCCATAGTAGGCATTGCCC AGG (reversed) Intergenic
No off target data available for this crispr