ID: 1114401901

View in Genome Browser
Species Human (GRCh38)
Location 14:22417881-22417903
Sequence TGAGAATCTCCAGGAAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 249}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114401901_1114401903 0 Left 1114401901 14:22417881-22417903 CCAGTTCTTCCTGGAGATTCTCA 0: 1
1: 0
2: 2
3: 29
4: 249
Right 1114401903 14:22417904-22417926 GAGCCACATTGAGAGAGCAGAGG 0: 1
1: 0
2: 1
3: 16
4: 218
1114401901_1114401905 26 Left 1114401901 14:22417881-22417903 CCAGTTCTTCCTGGAGATTCTCA 0: 1
1: 0
2: 2
3: 29
4: 249
Right 1114401905 14:22417930-22417952 TACAAGTGCTGCCCTATCCATGG 0: 1
1: 0
2: 0
3: 1
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114401901 Original CRISPR TGAGAATCTCCAGGAAGAAC TGG (reversed) Intergenic
902449448 1:16487407-16487429 TGAGAATCTCCAAGGACAATTGG + Intergenic
902879647 1:19362901-19362923 TCAGAAGCTCCAGGAAGATGAGG + Intronic
906568030 1:46814282-46814304 GGAGAATGTCCAGGAAGTCCAGG - Exonic
908794337 1:67816469-67816491 TGAGTGTGTCCAGGAGGAACAGG - Intronic
910674400 1:89802158-89802180 TGAGAATCACATGGAAGAACAGG - Intronic
917586506 1:176432696-176432718 TGATCATCTCCAGGAAGAGGAGG - Intergenic
919518275 1:198554752-198554774 AGAGAATCCCCAGGAGGAAAGGG - Intergenic
920013621 1:202888444-202888466 AGAGGATCCCCAGGAACAACTGG - Intronic
920054077 1:203180282-203180304 TGAAAATCTCCAGCAGGTACAGG - Intronic
920580800 1:207105618-207105640 TTACAAACTCCAGAAAGAACTGG - Intronic
921037119 1:211391251-211391273 TCAGAATCACCAGGAATTACTGG - Intergenic
1062935854 10:1388182-1388204 TGAGAATTTTCATGAAGAATGGG - Intronic
1063152241 10:3347329-3347351 TGGGAATCTCCAGGACCCACTGG + Intergenic
1064945784 10:20787284-20787306 TGATAGGCTCCGGGAAGAACAGG + Exonic
1065425561 10:25599271-25599293 GTAGCATCTCCAGGAAGAAGAGG + Exonic
1066261480 10:33733418-33733440 GAAGAGTCTCCAAGAAGAACAGG - Intergenic
1066264819 10:33766345-33766367 TGAGTAACTCAAGCAAGAACTGG - Intergenic
1066749855 10:38643518-38643540 GGAGAATCTCCTTGAATAACAGG + Intergenic
1066966787 10:42274202-42274224 GGAGAATCTCCTTGAATAACAGG - Intergenic
1067098270 10:43316400-43316422 AAAGCATCTCCAGGAAGACCTGG - Intergenic
1067494785 10:46752007-46752029 TGAGATTCCCCGGGGAGAACTGG - Intergenic
1067599870 10:47588390-47588412 TGAGATTCCCCGGGGAGAACTGG + Intergenic
1069862122 10:71478301-71478323 TGTGAATCTCCAGGCACAGCAGG - Intronic
1070397978 10:76029162-76029184 TGAGTATCTCCATTAACAACTGG + Intronic
1070590538 10:77797584-77797606 TGAGAGTCTCCAGAAAGAGCAGG + Intronic
1071498520 10:86187587-86187609 TGGGGAGCCCCAGGAAGAACAGG + Intronic
1071651405 10:87396273-87396295 TGAGATTCCCCGGGGAGAACTGG + Intergenic
1071840521 10:89465936-89465958 CCAGAATCTACAGGAAGAAGAGG - Intronic
1072329565 10:94334048-94334070 TAAGAATGTCTAGGAAGAAGAGG - Exonic
1074578581 10:114694439-114694461 TGAGAATCCCCAGGGATAGCTGG - Intergenic
1075414613 10:122253168-122253190 TGGGAATCTCAAGGAAAAGCTGG + Intronic
1080425297 11:32149144-32149166 GGAGGGTCTCCAGGAATAACAGG + Intergenic
1081004390 11:37716757-37716779 TGAGAATACCAAGGAAAAACTGG - Intergenic
1081069936 11:38598466-38598488 TGAGAATCACCTGAAAGAAAAGG + Intergenic
1082180320 11:49109229-49109251 TGAGAATATTCAGGAATAAAAGG - Intergenic
1084667217 11:70582921-70582943 TGAGAAGCCCCAGGAATCACTGG + Intronic
1085939042 11:81186278-81186300 TGAGAGTCTCCAGGGATCACAGG + Intergenic
1086810505 11:91304253-91304275 TAAGAATCTCTAGGAAGAAAGGG - Intergenic
1087258943 11:95989253-95989275 TTAGCATATCCAGGAAGAAGTGG - Intronic
1088042439 11:105403749-105403771 TAAAAACCTCCAGGAAAAACGGG + Intergenic
1089287194 11:117415246-117415268 ATAAAATCTCCAGAAAGAACTGG - Intergenic
1089866005 11:121632399-121632421 TGAGAAGCTCCAGGAACTACTGG + Exonic
1090614165 11:128499826-128499848 TGAGAATCACCAAGAAGGCCAGG + Intronic
1091073412 11:132590824-132590846 CCAGAATCTCCAGGACGAAAGGG - Intronic
1092461942 12:8694688-8694710 TGAGAATCAACAGGAGGGACCGG - Intronic
1094100662 12:26758626-26758648 TGAGAAGCTCCAGGTAGGACAGG + Intronic
1094376689 12:29797776-29797798 TGAGAGTCTCCAAGGAGAGCAGG + Intergenic
1095265587 12:40153430-40153452 TGAGAATCATCTGGAACAACAGG - Intergenic
1095567806 12:43646968-43646990 TGAGAATTTCCTGTTAGAACAGG + Intergenic
1096030934 12:48414278-48414300 AGCTTATCTCCAGGAAGAACTGG - Intergenic
1096905118 12:54928211-54928233 TGAGAATAACAAGTAAGAACAGG - Intergenic
1103954543 12:124568841-124568863 TGAGAACCCCCAGGGAGAGCGGG + Intergenic
1106073900 13:26440967-26440989 TGGGGAACTCCAGGAGGAACCGG + Intergenic
1106227570 13:27796533-27796555 TGCCTAGCTCCAGGAAGAACCGG - Intergenic
1106431066 13:29681076-29681098 TGAGAATCTCCAGCAGAAAGTGG + Intergenic
1107658660 13:42616811-42616833 TGAGAACCTCCTGGATTAACAGG - Intergenic
1108792441 13:53987738-53987760 TGGGAATCTCCAGGGGGAACTGG - Intergenic
1110511914 13:76361049-76361071 TGAGAAGCTGCAAGCAGAACTGG + Intergenic
1110534887 13:76639537-76639559 TGACAGTCTCCAGGAAGTAATGG + Intergenic
1110932889 13:81245156-81245178 TGTGAATGTGTAGGAAGAACTGG + Intergenic
1112728335 13:102330573-102330595 AGAGAAACTGGAGGAAGAACTGG - Intronic
1113404987 13:110030683-110030705 TGTGAAACTCCAGAAAGGACAGG - Intergenic
1113467797 13:110524433-110524455 CAAGAATGTTCAGGAAGAACGGG + Intronic
1114401901 14:22417881-22417903 TGAGAATCTCCAGGAAGAACTGG - Intergenic
1116206482 14:41873952-41873974 TCAGAATTTCAAGGAAAAACTGG + Intronic
1117412392 14:55462257-55462279 AGAGAATTTCCAGGAACAAAAGG + Intergenic
1117727611 14:58689909-58689931 ATAGAATCTCCAGAAAGAAAGGG + Intergenic
1118500961 14:66362147-66362169 TGAGAATCAGCTGGAAGACCTGG + Intergenic
1119049102 14:71348860-71348882 TAAGAATCTCCAGGCTGAAATGG + Intronic
1119341366 14:73881677-73881699 TTAGAATGTCCAGGGAGGACAGG - Intronic
1119594258 14:75919269-75919291 TGAGATTCTCCAAAAAGAATAGG + Intronic
1119877437 14:78072885-78072907 TGAGACTCTCCAACTAGAACAGG - Intergenic
1120034532 14:79681304-79681326 TCAGGAGATCCAGGAAGAACAGG - Intronic
1121233373 14:92374640-92374662 TGAGAAAATGCAGCAAGAACTGG - Intronic
1122179506 14:99944908-99944930 AGAGAATCTGCAGGAAGAACAGG - Intergenic
1122419323 14:101565119-101565141 TGGGAAGCTCCAGGAAGCCCAGG - Intergenic
1123459117 15:20452461-20452483 TGAGCATCACCAGGAGGAAGTGG + Intergenic
1123658944 15:22547957-22547979 TGAGCATCACCAGGAGGAAGTGG - Intergenic
1124265356 15:28228311-28228333 TGAGCATCACCAGGAGGAAGCGG + Exonic
1124312809 15:28642449-28642471 TGAGCATCACCAGGAGGAAGTGG - Intergenic
1127555902 15:60087364-60087386 TAAGAATACCCAGCAAGAACAGG + Intergenic
1127663677 15:61123697-61123719 TTAGAATCTCCTGGAAGACGGGG - Intronic
1128100154 15:64991954-64991976 TGAGAATCTCACAGAAAAACTGG + Intergenic
1128183633 15:65625799-65625821 TGAGGCTGTCCAGGAAGAAGAGG - Exonic
1128764079 15:70240372-70240394 TTAGTTTCTCCAGGAAGAACAGG - Intergenic
1130685762 15:86035954-86035976 TGAGAGTCTTCAGGAAAAAAGGG + Intergenic
1130767059 15:86881337-86881359 TGAGAATCACCAGGAGGATGTGG - Intronic
1133244370 16:4438007-4438029 TTGGAATCTCAATGAAGAACAGG + Intronic
1134352102 16:13447269-13447291 TCAGAAGCTGCAGGAACAACAGG + Intergenic
1135730570 16:24891645-24891667 TGAGAATATCCAGTAAGCAAAGG + Intronic
1138992438 16:62408236-62408258 AGAGAGTATCCAGGAAGAATAGG + Intergenic
1139245215 16:65435077-65435099 TGAGCATCTCTAGTAAGGACCGG + Intergenic
1139874209 16:70132269-70132291 TCAGAATCTACAGGAAGACTGGG + Exonic
1141827041 16:86487896-86487918 TCAGAGTCTCCAGAAGGAACTGG - Intergenic
1141940287 16:87271527-87271549 TGCGAGTCTCCAGGGAGAACTGG - Intronic
1143210077 17:5179427-5179449 TGAGAACCTCAAGGAGGACCTGG + Intergenic
1144625751 17:16843690-16843712 TGAGAACCTCAAGGAGGAGCTGG - Intergenic
1144627479 17:16851751-16851773 TGAGAACCTCAAGGAGGACCTGG - Intergenic
1144878962 17:18420968-18420990 TGAGAACCTCAAGGAGGACCTGG + Intergenic
1144880682 17:18429030-18429052 TGAGAACCTCAAGGAGGAGCTGG + Intergenic
1145151555 17:20515357-20515379 TGAGAACCTCAAGGAGGAGCTGG - Intergenic
1145153274 17:20523426-20523448 TGAGAACCTCAAGGAGGACCTGG - Intergenic
1146162905 17:30569615-30569637 TGAGAACCTCAAGGAGGAGCTGG - Intergenic
1146464843 17:33078256-33078278 CTAGCATCTCCAGGGAGAACTGG - Intronic
1147483665 17:40791358-40791380 TGAAAATCTCCAGCAAGAGAAGG - Intergenic
1147560133 17:41503677-41503699 TGTCAATCTCCAGGATGACCCGG + Exonic
1147579906 17:41622381-41622403 TGAGAACCTCAAGGAGGAGCTGG - Exonic
1147581607 17:41630445-41630467 TGAGAACCTCAAGGAGGACCTGG - Intergenic
1147888229 17:43698732-43698754 GGAGAATCTCAAGGAAAAGCAGG + Intergenic
1148581176 17:48745011-48745033 GGAGAAACTGAAGGAAGAACGGG + Intergenic
1148664570 17:49364699-49364721 AGAAAATCTTCAGGTAGAACAGG + Intergenic
1149525773 17:57354647-57354669 TGTGAACCTCCAGGAAGTGCAGG + Intronic
1150730091 17:67685320-67685342 TGAGGATCTCCAGGTATACCTGG + Intronic
1152689221 17:81710380-81710402 TGAGACACTCCAGGAAGGAGGGG - Intergenic
1152789169 17:82269388-82269410 CCAGAAGCTACAGGAAGAACAGG + Intronic
1153517876 18:5921426-5921448 TGCAAACCTGCAGGAAGAACTGG + Intergenic
1153530378 18:6040279-6040301 TGAATATCTCCAGGATGAAGGGG - Intronic
1155007526 18:21741585-21741607 TGAGTAACTCCCGGAATAACCGG + Exonic
1155246087 18:23910605-23910627 TGACCCTCTCCAGGTAGAACTGG - Intronic
1161572360 19:5037546-5037568 GGAGAGTCTCCAGAAAGAGCCGG + Intronic
1162737270 19:12753617-12753639 TGAGAATCCCCAGGGTGACCAGG - Intronic
1163422054 19:17219285-17219307 TCAGAACCTCCAGGAAAAGCTGG + Exonic
1164707645 19:30332303-30332325 TGAGGATCTCTGGGAAGAGCAGG - Intronic
1164836467 19:31358039-31358061 TCAGGACCTCCAGGAAGAGCTGG - Intergenic
1168196974 19:54782210-54782232 TGACGTCCTCCAGGAAGAACAGG + Intronic
1168283971 19:55321347-55321369 TGAGCATCTCCAGGAGGTCCTGG - Intronic
926679888 2:15654963-15654985 GCAGAATCCCCAGGAAGAAAGGG + Intergenic
926752739 2:16211177-16211199 TGAGAGACTGGAGGAAGAACAGG + Intergenic
929393500 2:41497133-41497155 TGGGAAACTCAAGGAAGAATAGG + Intergenic
930092632 2:47542258-47542280 TGAGCATCCTCAGGAAGACCAGG - Intronic
934312850 2:91885694-91885716 GGAGAATCTCCTTGAATAACAGG + Intergenic
934563013 2:95322985-95323007 TGGGATTCTCAAGGAAGAATGGG + Intronic
935222752 2:101028962-101028984 TGAGAAACTCCAGGAAGAGCAGG - Intronic
935712321 2:105909966-105909988 TTAGAAACTTAAGGAAGAACCGG - Intergenic
938588878 2:132718303-132718325 TGAGGATCTTCAAGTAGAACTGG - Intronic
939260020 2:139795337-139795359 TGGGAACCATCAGGAAGAACGGG + Intergenic
940544008 2:155060155-155060177 TGAGAATCTCCAATAGGAAAAGG - Intergenic
941731137 2:168919530-168919552 TGGGAATCTCCAGGATGATTAGG - Intergenic
942569319 2:177297400-177297422 TGAGAGTCTCCAGGATAAAAGGG - Intronic
942857187 2:180562819-180562841 TGAGTAGCTCCAGTAAGGACAGG - Intergenic
943847104 2:192664793-192664815 TGAGAATGTCAAGGTATAACTGG - Intergenic
944257756 2:197641161-197641183 TGAGAAAAGCCAGGAAGAACTGG + Intronic
944374302 2:199023412-199023434 TGAGAACCTCTAGAAGGAACAGG + Intergenic
945318116 2:208392459-208392481 TGAGCAACTCAAGGAAGAATAGG - Intronic
948080604 2:235202486-235202508 TGAGAGGTTCCAGGAAGGACAGG + Intergenic
948311692 2:236992013-236992035 TGAGAAGCTCTTGGAGGAACTGG - Intergenic
1168788378 20:559026-559048 TGAGAATCTGCAGGCTGAATTGG + Intergenic
1169388978 20:5174094-5174116 TTAAATTCTCCAGGAAGAACTGG + Intronic
1170780957 20:19424934-19424956 TCAGACTCTCCATAAAGAACAGG - Intronic
1172779127 20:37425292-37425314 GGAAAATCTCCAGAGAGAACTGG - Intergenic
1173304773 20:41837674-41837696 AGAGTAACTACAGGAAGAACTGG - Intergenic
1174220732 20:48952989-48953011 AGAGAATCCACAGGAAGAAGGGG - Intronic
1175449846 20:59054508-59054530 TGAGAATCACAAGGACAAACAGG - Intergenic
1175737159 20:61395011-61395033 TTAGAGTCTCCTGGGAGAACTGG + Intronic
1175989867 20:62783121-62783143 TGGGAGGCTCCAGGAAGAACTGG - Intergenic
1179284249 21:39962988-39963010 AGAGAATGTCCAGTAAGAAGAGG - Intergenic
1180101387 21:45589057-45589079 TGAGAATCTCCAGTTACAACAGG + Intergenic
1182150935 22:28026547-28026569 AGAGAATCACCAGCAAAAACTGG - Intronic
1182323646 22:29495035-29495057 TGAGGATCTCCATGAAGAGAAGG - Intergenic
1182336280 22:29585580-29585602 TGAGAAAGTCCAGGATAAACTGG - Intergenic
1183063021 22:35347059-35347081 TGACAAATTCCTGGAAGAACGGG + Exonic
1183542691 22:38438755-38438777 TGAGAAGCTGCAGGAAGGCCAGG + Intronic
1183686159 22:39362473-39362495 TGAGACTCTTCAGGAAGACAAGG + Intronic
1183739115 22:39660403-39660425 TGATAAGCTCCAGGAAGGCCTGG + Exonic
1185010153 22:48308456-48308478 TGAGAATATCCCTGAAGATCAGG + Intergenic
1185232215 22:49689780-49689802 TGAGAAGCCCCAGGACGCACTGG + Intergenic
949370567 3:3329914-3329936 TGAGCATCTCCACGCACAACTGG - Intergenic
950306603 3:11919643-11919665 TGAAATTCCCCAGGAGGAACAGG + Intergenic
950431153 3:12951978-12952000 CGAGAGTCTGCAGGAAGCACTGG + Intronic
951934289 3:28004140-28004162 TCAGAATCTCCAGAAGAAACTGG + Intergenic
951950074 3:28190366-28190388 TGAGAATACCCAAGAAGAGCCGG + Intergenic
952381639 3:32809894-32809916 TCAGAATCTCCATGAAGGACAGG - Intergenic
953583662 3:44180141-44180163 AGATGATCTCCAGGATGAACAGG - Intergenic
953962103 3:47274102-47274124 TCAAAATCTCCAGGAAGAGATGG + Intronic
954954091 3:54503818-54503840 CCAGAAGCTCCAGGCAGAACAGG - Intronic
955313327 3:57912409-57912431 TGAGAATCTCCGGGAGGAGAAGG + Exonic
956357009 3:68404911-68404933 TGAGATACTCAAGGAAGAAGTGG - Intronic
956643993 3:71438819-71438841 TGAGAATGTCAATGCAGAACCGG + Intronic
958487775 3:94733392-94733414 TGAGAATATCCAGAAAGCTCAGG + Intergenic
960251998 3:115465776-115465798 TGAGAACGTCCAGGGAGAACAGG - Intergenic
961522181 3:127473236-127473258 GGAGAATCTCCATGAAGGAATGG - Intergenic
961650793 3:128415836-128415858 TGAGGAACTCCAGGAAGCAGGGG - Intergenic
964740839 3:159964359-159964381 TGAGAATGTCCAGAAAGAGAGGG + Intergenic
965165297 3:165188939-165188961 TGAGAATCTCCAGGCTGGGCTGG + Exonic
971787644 4:31125209-31125231 AGAAAACCTCCAGGAAAAACAGG + Intronic
973004190 4:44988947-44988969 TCAGAACCTGAAGGAAGAACAGG + Intergenic
973641558 4:52907966-52907988 TAAGAATGTTCAGGAAAAACTGG - Intronic
975172331 4:71246427-71246449 GGAGAAGCACCTGGAAGAACAGG + Intronic
975550241 4:75605557-75605579 TCAGAATCTCCAGGAAATAGGGG + Exonic
976050027 4:81000669-81000691 TGAGGGTCTGCAGGAATAACAGG + Intergenic
976778475 4:88732189-88732211 TGTGTATCTCCAGGAAGAAGAGG - Exonic
976961989 4:90988824-90988846 TGAGATTCTCCAGCAAGATTTGG + Intronic
978650574 4:110999467-110999489 GGAAAATCACCAGGAAGAAGTGG - Intergenic
980038117 4:127907931-127907953 GGAGAAACTCCAGGAAGCAGAGG + Intergenic
980774726 4:137422974-137422996 AGCGAATCTCCAGGATGAAAGGG - Intergenic
981008466 4:139899951-139899973 TGAAATCCTCCAGGAAGAAAAGG + Intronic
983199355 4:164844171-164844193 TCAGAACCTCCAGAAGGAACAGG - Intergenic
983743831 4:171169451-171169473 TCAGAATCCCCAGGAAAAACTGG - Intergenic
984475948 4:180235065-180235087 CGAGAATTTCCAGGAGGAGCAGG - Intergenic
985216778 4:187661685-187661707 TGAGAATCTAAAGGAAAAAAAGG - Intergenic
986178018 5:5368353-5368375 TGAGCATCTACAGAAAGACCAGG + Intergenic
988232219 5:28494107-28494129 TGAAAATGTCCAGAAAGAAAGGG + Intergenic
988667037 5:33340401-33340423 TGGGAAACACCAGAAAGAACAGG + Intergenic
989182259 5:38590261-38590283 TGAAAATCCCCAGGGAGGACTGG + Intronic
989353047 5:40509770-40509792 TGACCATCTGCAGGAAGAAATGG + Intergenic
992160187 5:73993412-73993434 TGTAAATCTCCAGGTAGAAGTGG + Intergenic
995555555 5:113324670-113324692 TGAGAATCTAAAGGTAGCACTGG + Intronic
995932252 5:117460820-117460842 ATATAATTTCCAGGAAGAACAGG + Intergenic
995934964 5:117499858-117499880 TGTAAATCTTCAGGAAGAAAAGG + Intergenic
996491729 5:124105860-124105882 TGGGAATCTCTTGAAAGAACCGG + Intergenic
996540734 5:124628424-124628446 TGAGAATCTGCAATTAGAACTGG + Intergenic
996544194 5:124660378-124660400 TGGCCACCTCCAGGAAGAACAGG - Intronic
997744547 5:136287596-136287618 TTTGAAGCTCCAGGAGGAACGGG + Intronic
997862241 5:137428456-137428478 TGAGTAACTCCAGGAAGAGTCGG - Intronic
999109434 5:149105548-149105570 TGAGAATATTCAGGAAAAAAAGG - Intergenic
1000341523 5:160280666-160280688 TCAGGATGTCCACGAAGAACCGG + Exonic
1002465921 5:179408565-179408587 TGAGTATCTACAAGAAGAATTGG + Intergenic
1006188285 6:32192483-32192505 TGAGAGACCCCAGGAAGAAGAGG - Exonic
1007696268 6:43736126-43736148 TGGGAATCTCCAGGAAAGAGAGG + Intergenic
1008531832 6:52468440-52468462 TGAGTATATTCAGGAAAAACAGG + Intronic
1012943466 6:105441553-105441575 TGAGAATCTTCAGAAAGGAGTGG - Intergenic
1013003119 6:106044576-106044598 AAAGAATTTCCAGGAAGCACTGG - Intergenic
1013469837 6:110453288-110453310 TGAGAATCAACAGAAACAACTGG - Intronic
1014277139 6:119399820-119399842 TTATAATCTGCAGGAAGGACTGG - Intergenic
1014822883 6:126012785-126012807 AGAGAATCTACAAGAAGAACAGG + Exonic
1015113250 6:129618229-129618251 TTAGAATGTCCAGGAACAAAGGG + Intronic
1015602680 6:134925943-134925965 TGGTATTTTCCAGGAAGAACAGG + Intronic
1019037996 6:169078294-169078316 TGAGTTTCTCCAGGAGGACCAGG + Intergenic
1019706227 7:2498465-2498487 ACACAACCTCCAGGAAGAACAGG + Intergenic
1019842135 7:3457675-3457697 GGAAGATCTCCAGGAAGAAAAGG - Intronic
1021278712 7:18689556-18689578 TGAAAATCTCCAAGAATATCAGG - Intronic
1021936669 7:25638297-25638319 TGAGAATCTCCAGAGAGAAGAGG + Intergenic
1022666555 7:32416381-32416403 TGTGAGTCTCCTGGAGGAACAGG - Intergenic
1022925418 7:35051685-35051707 TGAGTAACTCCAGGAAAAAAGGG - Intergenic
1025957875 7:66196573-66196595 TGAGAAGCTCCAGGAAGGAGAGG - Intergenic
1026400247 7:70004602-70004624 TGAGAACAGCAAGGAAGAACTGG + Intronic
1028510565 7:91620911-91620933 TGAAAATATCCAGGAAGAGGGGG - Intergenic
1029823434 7:103166383-103166405 TGAGTAACTCCAGGAAAAAAGGG - Intergenic
1030583734 7:111391163-111391185 AAAGAATCTCTAGGAAGCACAGG + Intronic
1032541964 7:132710750-132710772 TGGGTTTCTCTAGGAAGAACTGG - Intronic
1033279160 7:139993555-139993577 TGAGAATCTCAAGAAAGACAAGG - Intronic
1033600108 7:142883332-142883354 TGAGTCTCTCCAGGATGATCGGG - Intronic
1034038708 7:147853016-147853038 TTAAATTCTCCAGGAAGAAAGGG + Intronic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1036214739 8:6869892-6869914 TGAGAATCTCCAGGACTACTTGG - Intergenic
1036436922 8:8743152-8743174 TGAGAAACTCCTGGATTAACTGG + Intergenic
1038632098 8:29255619-29255641 TGAGAAACTCCAGGTAGAAGGGG - Intronic
1039078216 8:33711388-33711410 TGAGCTGCTCCAGGAAGAACAGG - Intergenic
1041387209 8:57317399-57317421 TGAGAGTCTCCAGGAAGCAAAGG + Intergenic
1043735862 8:83742584-83742606 TCAGAACCTCCATGAAGATCTGG + Intergenic
1045353409 8:101363019-101363041 TGAGAATTTACAGCAAGGACAGG + Intergenic
1045404395 8:101851127-101851149 TAAGATTCTCCAGGGATAACAGG - Intronic
1046851581 8:118980281-118980303 TGAGAATCTCCAGGAGGTGGAGG - Intergenic
1047962966 8:130024372-130024394 ATAGAATCTCCAGGAAAAAGTGG + Intergenic
1048188318 8:132264495-132264517 GGAGAATCAACAGGAAGAAATGG + Intronic
1049016136 8:139921539-139921561 TGAGAAGCTTCAGGAAGAGCTGG + Intronic
1049494550 8:142923624-142923646 TGAGATTCCCGAGGAAGAACAGG - Intergenic
1049757934 8:144319032-144319054 TGAGGTTCTCCAGAAATAACCGG + Exonic
1049955113 9:686002-686024 TAAGACTCTCCAGGAAGAAAGGG + Intronic
1049997806 9:1047945-1047967 TGAGGTCCTCCAGGAAGCACTGG + Intergenic
1053418557 9:37962277-37962299 TGAGAAGCTCCAAGAAGATAGGG + Intronic
1054451758 9:65407044-65407066 TTGGATTCTCCAGGAAGCACTGG + Intergenic
1057456081 9:95212637-95212659 TGTGTATCTGCAGGAAGAAAGGG + Intronic
1057792331 9:98132422-98132444 GAAGAATCTCCAGGCAGAGCTGG - Intronic
1185561229 X:1061962-1061984 TTAGAGCCTCCAGAAAGAACTGG - Intergenic
1186244416 X:7605555-7605577 TGCAAATTTCCAGGAAGAATCGG + Intergenic
1186244495 X:7606525-7606547 TGCGAATATCCAGGAAGAATTGG - Intergenic
1189672441 X:43425283-43425305 TCAGAATCTCCAGAAAGACCAGG + Intergenic
1190332249 X:49243078-49243100 TCAGAATCTCCAGGGTGAAGTGG - Intronic
1190407639 X:50103551-50103573 TGAAAATGTTCAGGATGAACAGG - Intergenic
1195173679 X:102294454-102294476 TGAGACTGTTCAGGAAGAACAGG + Intergenic
1195185186 X:102392639-102392661 TGATACTGTTCAGGAAGAACAGG - Intronic
1197651881 X:129074041-129074063 TGATAGTCTCAAGGTAGAACAGG + Intergenic
1198018413 X:132634712-132634734 TTAGATTCTCCAGGAAGGACTGG - Intronic
1198439246 X:136645916-136645938 GGAGAATCTTAAGGGAGAACAGG + Intergenic
1198658583 X:138941856-138941878 TGAGGAACTCCAGGAATAAGGGG - Intronic
1199613014 X:149633692-149633714 TGAGGAAATACAGGAAGAACTGG + Intergenic
1200934199 Y:8724024-8724046 AGAGCAACCCCAGGAAGAACAGG + Intergenic
1201262390 Y:12172747-12172769 TGAGAATATCCAGAGAGAAAAGG - Intergenic
1201463706 Y:14256779-14256801 TGCGAATATCCAGGAAAAATTGG - Intergenic
1201671435 Y:16525862-16525884 TGAAAATCACCAGGCAGTACAGG + Intergenic