ID: 1114401985

View in Genome Browser
Species Human (GRCh38)
Location 14:22418515-22418537
Sequence ATGGAAGAGCTGAGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 812
Summary {0: 1, 1: 0, 2: 18, 3: 162, 4: 631}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114401985_1114401989 -6 Left 1114401985 14:22418515-22418537 CCTTCCACCCTCAGCTCTTCCAT 0: 1
1: 0
2: 18
3: 162
4: 631
Right 1114401989 14:22418532-22418554 TTCCATTCTGTTCCCAAATGAGG 0: 1
1: 0
2: 2
3: 31
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114401985 Original CRISPR ATGGAAGAGCTGAGGGTGGA AGG (reversed) Intergenic
900555934 1:3280537-3280559 ATGGAAGGCCTGAGGTGGGAAGG - Intronic
900715657 1:4141839-4141861 ATGGTGGAGTGGAGGGTGGACGG + Intergenic
900864254 1:5255899-5255921 AGGGAGGAGCAGAGGATGGAGGG + Intergenic
900997323 1:6129729-6129751 ATGGAAGGGCTGTGGGGGGAGGG - Intronic
901006675 1:6175066-6175088 ATGGATGAGTGGATGGTGGATGG + Intronic
901006731 1:6175341-6175363 ATGGATGAGTGGATGGTGGATGG + Intronic
901787301 1:11633136-11633158 GTGGCAGAGCTGGGAGTGGACGG - Intergenic
902105516 1:14032671-14032693 TTGGAAGAGCTGAGCCAGGATGG - Intergenic
902315707 1:15617249-15617271 GTGGAAGAGGAGAGGGAGGAAGG - Intergenic
902597932 1:17521829-17521851 ATGGTGAAGCTGAGGTTGGAAGG + Intergenic
902609347 1:17588156-17588178 CTGGAGCAGCTGGGGGTGGAGGG + Intronic
902712525 1:18250058-18250080 ATGGAAGGGGGGAGGGAGGAGGG - Intronic
903000336 1:20260973-20260995 AAGAAAGAACTGAGTGTGGAGGG - Intergenic
903049233 1:20588710-20588732 AGGGAAGGGCTGAGGCTGAAAGG - Intergenic
903417333 1:23192902-23192924 CTGAAAGAGCTGTGGGTGGTGGG - Exonic
903479824 1:23645090-23645112 ATGGAGGAGCTGTGGGGGCAGGG - Intergenic
903643942 1:24879519-24879541 ATGCAAGAGCTGTGGGGGCATGG - Intergenic
903963767 1:27073287-27073309 TTGGAAGTGCAGAGGGAGGATGG - Intergenic
905805496 1:40874107-40874129 TTGGAAGCCCTGAGGCTGGAGGG + Intergenic
905999158 1:42408909-42408931 ATGGAAAAGCTGATGTTGGCCGG + Intronic
906105106 1:43286819-43286841 ATGGTAGAACTGTGGCTGGAAGG + Intergenic
906730039 1:48072890-48072912 ATGAAAGAGCTCAGGTTGAAGGG + Intergenic
906820572 1:48925916-48925938 ATGGCAGAGATGAGGGTTGTAGG - Intronic
907915128 1:58861327-58861349 AGGGAAGAAGTGAGGGAGGAAGG + Intergenic
908010867 1:59776449-59776471 GTGGAAGAGGTGAAGGTGTATGG - Intergenic
908147214 1:61259358-61259380 ATGGAAGAACAGAGAGGGGAAGG - Intronic
908195731 1:61743877-61743899 ATGGAAGAGGGGAGGGTAAAAGG + Intronic
908267507 1:62393880-62393902 ATGGAAGCCCTGGGGGTGGTTGG - Intergenic
909014566 1:70368611-70368633 AAGGAAGACTGGAGGGTGGAAGG - Intronic
910197139 1:84653424-84653446 ATGCAAGACCTGAGGGCTGATGG - Intronic
912700893 1:111877533-111877555 AGGGAAGAGAGGAGTGTGGAGGG + Intronic
913082700 1:115403566-115403588 ATGGAGGAGCTCAGTCTGGAGGG - Intergenic
913223132 1:116675408-116675430 ATGGAAGATCTGAGAGAAGAGGG + Intergenic
913549424 1:119903015-119903037 ATGCAAGAACTGTGGGAGGATGG + Intergenic
915860755 1:159441807-159441829 ATGGAAGAGGTGGGGATTGAAGG + Intergenic
915913788 1:159929609-159929631 GTAGCAGGGCTGAGGGTGGAGGG + Intronic
915924023 1:160002550-160002572 ATGGAAGATGTGAGGGTGAGGGG - Intergenic
916169691 1:161992528-161992550 ATGTCAGAGCTGAGCGAGGATGG - Intronic
916631457 1:166618496-166618518 AAGGAAGAAATGAGAGTGGATGG - Intergenic
917130617 1:171738728-171738750 ATGAAAGAGCAGAGAGTAGAGGG + Intronic
917489859 1:175488846-175488868 GTGGAATAGGTGAGGGAGGAAGG + Intronic
918092431 1:181308988-181309010 ATGGAAGTTCTGTAGGTGGAGGG + Intergenic
918543145 1:185653716-185653738 ATGGAAGACCTCAGGTAGGAAGG + Intergenic
919091079 1:192979579-192979601 AAGGAGGAACGGAGGGTGGAAGG + Intergenic
919202396 1:194372715-194372737 ATGGGAGAGTGGAGGGTGGCAGG - Intergenic
920133753 1:203753260-203753282 ATGGAGGTGAGGAGGGTGGAGGG - Intergenic
922330932 1:224574872-224574894 ATGGAAGAGCTGGTGGATGAAGG + Intronic
922417570 1:225435649-225435671 TTGGTAGAACTGAGGGTGGAGGG - Intergenic
922584679 1:226724688-226724710 ATGGAAGAGCTCTAGGGGGAGGG - Intronic
922662359 1:227441198-227441220 ATGGAAGTGTGGAGGCTGGAGGG + Intergenic
922664254 1:227455225-227455247 AGGGAAGAGCTGTGGAAGGAAGG + Intergenic
923216186 1:231850176-231850198 AAGGAACAGAGGAGGGTGGAGGG + Intronic
923399565 1:233603145-233603167 GTGGAAGACATGAAGGTGGAAGG + Intergenic
924003928 1:239586038-239586060 ATGGAAGAGTAGAAAGTGGATGG - Intronic
924112170 1:240711116-240711138 ATGGAGGCGCTCAGGGTGGCAGG - Intergenic
1062908152 10:1193053-1193075 GTGGAGGTGTTGAGGGTGGAAGG + Intronic
1063082757 10:2783796-2783818 ATGGAAGAGGCAAGGATGGATGG + Intergenic
1063427235 10:5959998-5960020 ATGGAGGAGCTGAGGGTAATGGG - Intronic
1063428005 10:5964835-5964857 ATGGGAAAGCTGAGCGTGGCGGG - Intronic
1063690211 10:8280079-8280101 AAGGAAGAAGAGAGGGTGGAAGG + Intergenic
1064287292 10:14002964-14002986 TGGGAAGAGGTGAGGCTGGAGGG + Intronic
1064473202 10:15658452-15658474 ATGTAGGAGCTGAGGACGGAGGG - Intronic
1065181421 10:23129847-23129869 TGGTAAGAGATGAGGGTGGAGGG + Intergenic
1065302966 10:24340581-24340603 AGGGAAGAGATGCGGGTGGAGGG - Intronic
1065302971 10:24340600-24340622 AGGGAAGAGATGTGGGTGGAGGG - Intronic
1065307574 10:24383471-24383493 AAGGAATGGCTGAGGGTGGCGGG + Intronic
1065521620 10:26579433-26579455 ATGGAAGGGCGGCGCGTGGAGGG + Intergenic
1066051090 10:31636284-31636306 ATGGAGGTGCAGAGGGTTGAAGG + Intergenic
1066190010 10:33047486-33047508 AAGGGAGAGAAGAGGGTGGATGG + Intergenic
1066437508 10:35407714-35407736 AAGGAGGAGTGGAGGGTGGAAGG + Intronic
1067065740 10:43103120-43103142 AGGGAAGAGCTGAGGCTGATGGG + Intronic
1067144227 10:43682124-43682146 AGGCAAGAGCTGATGGTGGCTGG + Intergenic
1067267263 10:44757084-44757106 ATGGGAGAGATGGGGATGGAGGG - Intergenic
1067487913 10:46669106-46669128 ATCGAAGAGCTGAGGATACAAGG - Intergenic
1067606895 10:47672902-47672924 ATCGAAGAGCTGAGGATACAAGG + Intergenic
1067748682 10:48956042-48956064 ATGAAGGTGCTGGGGGTGGAGGG - Intronic
1069780783 10:70954103-70954125 ATGGATGTGCTGAGGGAAGAAGG - Intergenic
1069943214 10:71969435-71969457 AGGGCAGAGATGAGGGTGGGTGG - Intronic
1069974029 10:72198193-72198215 ATGGAAGGGGTGAGGAGGGAGGG + Intronic
1069974064 10:72198284-72198306 ATGGAAGGGGTGAGGAGGGAGGG + Intronic
1069989170 10:72303939-72303961 ATGGGAGAGCTGAGTGTAGCAGG + Intergenic
1070395970 10:76011498-76011520 ATGGAGGAACTGAGGATGGAGGG - Intronic
1070648936 10:78221190-78221212 TTGGGAAAGCTGAGGCTGGAAGG + Intergenic
1070721769 10:78761798-78761820 ATTGAAGGGCTGTGGGTGGTTGG - Intergenic
1070823249 10:79375528-79375550 CTGCAGGAGCTGAGTGTGGAGGG + Intergenic
1070828506 10:79404826-79404848 GTGTAAGTGCTGTGGGTGGAAGG - Intronic
1072010300 10:91297785-91297807 ATGAAAGAACTGAGTGGGGAAGG - Intergenic
1073550819 10:104399574-104399596 TTGGAAGAGCTTAGAGAGGAAGG - Intronic
1073802270 10:107055066-107055088 CTGGAAGAGCACAGAGTGGAAGG + Intronic
1074359429 10:112813206-112813228 AGGGAAGAGCTGAGGATTTAAGG + Intronic
1074913480 10:117933922-117933944 AGGGAAGGGTTGAGGGAGGAGGG + Intergenic
1075111927 10:119595231-119595253 AGGGAATAGATGAAGGTGGAGGG - Intronic
1075191963 10:120317399-120317421 GTGGAAAAGTTGAGGGTGAAGGG - Intergenic
1075632636 10:124010491-124010513 TTGGAAGCACTGAGGGAGGAAGG + Intronic
1076150682 10:128159790-128159812 GTAGGACAGCTGAGGGTGGAGGG + Intergenic
1076244693 10:128937643-128937665 AGGCAAGACCTGAGGCTGGATGG - Intergenic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1076396537 10:130142315-130142337 TTGGGAGAGGTGAGAGTGGAAGG - Intronic
1076655646 10:132021815-132021837 GTGGAAGAGGTGTTGGTGGAGGG + Intergenic
1076899996 10:133333696-133333718 AAGAAAGATCTGAGAGTGGAAGG + Intronic
1076987501 11:249524-249546 ATGGGAGAGCGGTGGGTGCAGGG + Intronic
1077280527 11:1743014-1743036 ATGGATGGATTGAGGGTGGATGG + Intronic
1077487992 11:2847912-2847934 CAGGAAGAGCTCAGGGTCGACGG - Exonic
1077612036 11:3649168-3649190 ACGGAGGAACGGAGGGTGGAAGG - Intronic
1077811877 11:5646432-5646454 ATGGAAGAGATAAGGGAGGATGG - Intergenic
1078426991 11:11260046-11260068 ATGGGAAAGATGGGGGTGGAAGG - Intergenic
1079258924 11:18858860-18858882 GTGGAAGATCTGAGGGTGATAGG - Intergenic
1080886962 11:36376495-36376517 AGGGCAGAGCTGGGGGAGGAGGG + Intronic
1081346839 11:41997980-41998002 AGGGAAGATGTCAGGGTGGAGGG + Intergenic
1081465335 11:43311776-43311798 ATGGAAGGGGTGTGGGTGGGCGG - Intergenic
1083196604 11:61092160-61092182 GGGGAGGAGCTGAGGGTGGGAGG - Intergenic
1083446893 11:62714144-62714166 ATAGAAGAGGGGAGGGTGGTGGG - Exonic
1083689444 11:64398101-64398123 ATGAAAGACGTGAGGGTGGCAGG + Intergenic
1083713057 11:64560443-64560465 CTGGTGGAGCTGGGGGTGGATGG - Intronic
1083796501 11:65019933-65019955 TTGGGAGAGATGTGGGTGGACGG - Intronic
1083996490 11:66275620-66275642 ATGGAAGAGGGCAGGGAGGAAGG + Intronic
1084095355 11:66907688-66907710 TTAGAAGAGCAGAGGGTAGAAGG - Intronic
1084465386 11:69320280-69320302 CTGGAAGACCTGAGATTGGAAGG + Intronic
1084765566 11:71305959-71305981 CTGGAAGGGCTGTGGGTGGGGGG + Intergenic
1085701998 11:78754018-78754040 ATGGAAGAACTGAGGGAGGGAGG - Intronic
1085762901 11:79257550-79257572 TTGGAAGGGTGGAGGGTGGAGGG + Intronic
1088589994 11:111395157-111395179 ATGGAGGAGCTGTTGCTGGATGG - Intronic
1089472228 11:118730614-118730636 AAGGAGGAATTGAGGGTGGAAGG + Intergenic
1089496663 11:118911495-118911517 ATGGAGAAGCTGGGGGTGGCGGG - Intronic
1089625644 11:119749132-119749154 ATGGAAGAGGTGAAGGAGAAGGG - Intergenic
1090943944 11:131413084-131413106 AGGGAAGAGTTGAGGCAGGAAGG - Intronic
1091697156 12:2635517-2635539 ATGGAGGAGCTGGGGGTGGTGGG - Intronic
1091956705 12:4649962-4649984 GTGGAAGAGTAGAGGGTGAAAGG - Intronic
1092021702 12:5208205-5208227 AGGGAAGAGCTGGTGGTGGAGGG - Intergenic
1095881687 12:47144071-47144093 ATGCAAGAGCTGTGGGGGCATGG - Intronic
1096406345 12:51346729-51346751 CTGGCAGGGCTGAGGGTGCAAGG + Intergenic
1096666218 12:53167362-53167384 ATGGTTGAGCTGAGACTGGAAGG - Intronic
1096807347 12:54148799-54148821 AGGGAACAGCTGGGGGTTGAAGG - Intergenic
1096911271 12:54986757-54986779 ATGGGAGGGTAGAGGGTGGAAGG - Intergenic
1097694038 12:62759995-62760017 AAGGAAGAATGGAGGGTGGAAGG - Intronic
1097903418 12:64896069-64896091 ATGAAAAAGCTGAGGGGGGCAGG - Intergenic
1098291210 12:68958427-68958449 ACAGAAAAGCTGGGGGTGGAGGG - Intronic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1100888446 12:99098764-99098786 ATGGCAGAGCTGGGGGTGGGGGG - Intronic
1101396600 12:104354171-104354193 TTAGAAGAGGTGGGGGTGGAGGG + Intergenic
1101726235 12:107390659-107390681 ATGGTACTACTGAGGGTGGAGGG + Intronic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1102491696 12:113293244-113293266 AAGGAAGAGCAGAGGCTGCAGGG - Intronic
1102556385 12:113729472-113729494 ATGGTGAAGGTGAGGGTGGATGG + Intergenic
1102615094 12:114146688-114146710 AAGGAACAGGTGAGTGTGGAGGG - Intergenic
1102678800 12:114676243-114676265 CTGGAAGAGTTGAAGGGGGATGG - Intronic
1102879272 12:116471902-116471924 ATACAAGAGCTGAGGGAGGTAGG + Intergenic
1102926339 12:116829133-116829155 ATGGGGCAGCTGAGGGTGGGTGG + Intronic
1103077092 12:117992645-117992667 ATGGCAGAGCTGAGGCTAAAAGG + Intergenic
1103867345 12:124063639-124063661 TGGGAAGAGCTGAGCATGGAGGG - Intronic
1104010307 12:124925556-124925578 ATGGAAGAGGATAGGGAGGACGG - Intergenic
1104092404 12:125527294-125527316 ATGGAAGAGTGGAGGGTGGATGG - Intronic
1104092426 12:125527361-125527383 ATGGAAGAGTGGAGGGTGGATGG - Intronic
1104443007 12:128810676-128810698 AAGGAAGAGCTGTTGGGGGAGGG + Intronic
1104690164 12:130819315-130819337 AAGGAAGAGGGGAGGGTGGGAGG - Intronic
1104743892 12:131198376-131198398 ATGGAAGAACTACTGGTGGAGGG + Intergenic
1105396149 13:20037942-20037964 ATGAAAGAGTGGAGGGTGGGAGG - Intronic
1105423562 13:20273691-20273713 ATGGCACAGGTTAGGGTGGAGGG - Intergenic
1106169705 13:27278462-27278484 ATCACAGAGCTGAGGGCGGATGG + Intergenic
1106762953 13:32885027-32885049 AGGGAAGAGCTGTCGATGGAAGG + Intergenic
1107002973 13:35572611-35572633 TTGGAAGTATTGAGGGTGGATGG - Intronic
1107046666 13:36000118-36000140 ATGGAAGAACTGAGGGAATAGGG - Intronic
1107383982 13:39888500-39888522 ATGAAAGAGCAGAGGGTGGCTGG - Intergenic
1107650627 13:42541274-42541296 AAGCAAGAGTTGAGGGTGGGGGG - Intergenic
1107688659 13:42929669-42929691 AAGGAAGGGATGAGGGTGGAGGG + Intronic
1107978959 13:45715990-45716012 CTGCAAGAGATGAGGGTGGTTGG + Intergenic
1108190392 13:47932462-47932484 ATGGAGCAGCTTTGGGTGGAGGG - Intergenic
1108305886 13:49132190-49132212 TGGCAAGAGCTGATGGTGGATGG - Intronic
1109048298 13:57441470-57441492 ATGCAAGAGGTGGAGGTGGAGGG + Intergenic
1109116770 13:58398448-58398470 ATGGAACAGCTCAGTGTAGAGGG + Intergenic
1109942610 13:69390888-69390910 ATTGAAGATCTGAATGTGGAAGG - Intergenic
1110802746 13:79718656-79718678 AGGGATGATTTGAGGGTGGAAGG - Intergenic
1110945086 13:81403768-81403790 ATTAAAGAGCTGAGGTTGTAGGG - Intergenic
1113139607 13:107132627-107132649 ATGGAAGAGGTGAGGTAGCATGG - Intergenic
1113874950 13:113588369-113588391 ATCCAAGACCTGAGGCTGGAAGG + Intronic
1113971460 13:114194516-114194538 ATGGAAGGGAGGAGGGTGGAAGG + Intergenic
1114401985 14:22418515-22418537 ATGGAAGAGCTGAGGGTGGAAGG - Intergenic
1114402505 14:22422806-22422828 ATGGAGCACCTGAGGGTGGCAGG - Intergenic
1114423008 14:22600311-22600333 CTTGAAAAGCTGAGGCTGGAAGG + Intronic
1114437289 14:22716989-22717011 GTGGCAGAGTTGAGGGGGGAGGG - Intergenic
1114467496 14:22933837-22933859 AGGCAAGCGCTGAGGGAGGAGGG - Intergenic
1114647347 14:24263134-24263156 ATGGAACAGGTCAGGATGGATGG + Exonic
1115555613 14:34543005-34543027 ATGGTAGAGCAGACGGAGGAGGG - Intergenic
1115558295 14:34560088-34560110 ATGGTAGAGCAGACGGAGGAGGG + Intergenic
1115896222 14:38090731-38090753 ATGGAACAGCTGGGGCTGGCTGG - Intergenic
1117651774 14:57915013-57915035 ATGCAAGAGCTGTGGGGGCATGG - Intronic
1117826167 14:59705936-59705958 AAGGAAAAGCTGGGGGTGAACGG - Intronic
1118069989 14:62235673-62235695 ATGGAAGAACTGAGATTTGAGGG - Intergenic
1118561272 14:67086295-67086317 AAGGAAGAGCAGTGGGTAGAGGG + Intronic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1119119802 14:72064172-72064194 CTGGAAGAGGTGAAGGAGGAGGG + Intronic
1119679783 14:76583971-76583993 GTGGGAGAGCTGCGGGTTGAGGG + Intergenic
1120335730 14:83151754-83151776 AGGGAAGAGGAGGGGGTGGAAGG + Intergenic
1121995804 14:98602083-98602105 ATGGAAATGCTGGGGGAGGAGGG - Intergenic
1122165471 14:99820040-99820062 ATGGAAGAGCTGAGCATGTCTGG + Intronic
1122302537 14:100739155-100739177 CTGTGAGGGCTGAGGGTGGAAGG - Intergenic
1122484126 14:102066517-102066539 AAGAAAGAGCTGTGGGTGGCTGG - Intergenic
1122618864 14:103041695-103041717 TTGGAGGAGCTCAGGGTGGCTGG + Intronic
1122923784 14:104890710-104890732 ATGGATGAGTGGTGGGTGGATGG + Intronic
1123724224 15:23086165-23086187 ATGGAAGAGAGGAAGGTTGAAGG + Intergenic
1124708810 15:31987665-31987687 TTGGAAGAGCTATGGGTGCAGGG - Intergenic
1124967530 15:34447479-34447501 AGGGAAGAGATGAGGGAGGAGGG - Intergenic
1125131658 15:36290092-36290114 AAGGAAGAATGGAGGGTGGAAGG + Intergenic
1126634085 15:50765277-50765299 GTGGAAAAGAGGAGGGTGGAAGG + Intronic
1126863622 15:52913203-52913225 ATGAGAGAGCTGAGGTTGCAGGG - Intergenic
1127167166 15:56256933-56256955 ATGGGAGAGCAGAGGGTGGGAGG - Intronic
1127346926 15:58110324-58110346 ATGGAGAAGGTGAGGGTAGAAGG + Intronic
1128072596 15:64807111-64807133 ATGGAGGGTCTGAGGTTGGATGG - Intergenic
1128107143 15:65053537-65053559 ATGGAGGAGCTGAGGTCAGAGGG - Exonic
1128451810 15:67810212-67810234 ATGGATGGGGTGAGGGTGGGCGG - Intergenic
1128796468 15:70470120-70470142 ATGCAGGAGCTGAGGGAGGATGG - Intergenic
1128885773 15:71286306-71286328 ATGGAAGGGCAGAGGGTGGGAGG - Intronic
1129054948 15:72812638-72812660 AGGGAAGGGATGAAGGTGGAAGG - Intergenic
1129168237 15:73791499-73791521 ATGGGAGAGCTGTGGGAGGCAGG + Intergenic
1129169102 15:73797108-73797130 AAGGAACAGCTGTGGGAGGAGGG - Intergenic
1129663636 15:77567167-77567189 ACAGGAGAGCTGAGGGTTGATGG + Intergenic
1130966274 15:88700102-88700124 AAGGAAGGGCTGAGGGAGTATGG + Intergenic
1131289907 15:91098741-91098763 GGGGAAAAGATGAGGGTGGAGGG + Intergenic
1131340857 15:91599260-91599282 ATGGAAGGGCAGGGGGTGGAGGG + Intergenic
1131856718 15:96605178-96605200 ATGGAAGAGCAGAGGAACGAAGG + Intergenic
1131872715 15:96778295-96778317 ATTGAACAGCAGAGGGTGGGGGG - Intergenic
1132191180 15:99862439-99862461 AGGGAAGAGATGAGGGAGGAGGG + Intergenic
1132311380 15:100860530-100860552 CATGAAGAGCTGGGGGTGGAGGG - Intergenic
1132784059 16:1644699-1644721 AGTGCAGAGCTGAGGCTGGAGGG + Intronic
1133393225 16:5426003-5426025 GTGGAAGTGCTGCTGGTGGAAGG + Intergenic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1133839458 16:9394616-9394638 AAGGAGGAAGTGAGGGTGGAAGG - Intergenic
1134165703 16:11927624-11927646 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1134495010 16:14726059-14726081 AGGGTAGAGCTGAGGGTGGAAGG - Exonic
1134495031 16:14726185-14726207 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1134500394 16:14765179-14765201 AGGGTAGAGCTGAGGGTGGAAGG - Exonic
1134500415 16:14765305-14765327 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1134526934 16:14951791-14951813 AGGGTAGAGCTGAGGGTGGAAGG - Exonic
1134526955 16:14951917-14951939 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1134545448 16:15104433-15104455 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1134545461 16:15104504-15104526 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1134580165 16:15363745-15363767 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1134580176 16:15363814-15363836 AGGGTAGAGCTGAGGGTGGAAGG + Exonic
1134692021 16:16197416-16197438 AAGGAGGAGATGGGGGTGGAAGG + Intronic
1134714521 16:16350325-16350347 AGGGTAGAGCTGAGGGTGGAAGG - Intergenic
1134714543 16:16350451-16350473 AGGGTGGAGCTGAGGGTGGAAGG - Intergenic
1134722396 16:16393689-16393711 AGGGTAGAGCTGAGGGTGGAAGG - Exonic
1134722418 16:16393815-16393837 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1134945009 16:18318054-18318076 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1134945031 16:18318180-18318202 AGGGTAGAGCTGAGGGTGGAAGG + Exonic
1134952273 16:18358207-18358229 AGGGTGGAGCTGAGGGTGGAAGG + Intergenic
1134952295 16:18358333-18358355 AGGGTAGAGCTGAGGGTGGAAGG + Intergenic
1135310704 16:21402736-21402758 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135310725 16:21402862-21402884 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135310747 16:21402988-21403010 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310769 16:21403114-21403136 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310791 16:21403240-21403262 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310837 16:21403505-21403527 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310858 16:21403631-21403653 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310880 16:21403757-21403779 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310901 16:21403883-21403905 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310918 16:21404009-21404031 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310935 16:21404113-21404135 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310958 16:21404240-21404262 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310998 16:21404479-21404501 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135311021 16:21404603-21404625 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135311043 16:21404729-21404751 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135311066 16:21404867-21404889 AGGGTAGAGCTGAGGGTGGAAGG + Exonic
1135363652 16:21835170-21835192 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363674 16:21835296-21835318 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363696 16:21835422-21835444 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363718 16:21835548-21835570 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135363740 16:21835674-21835696 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363762 16:21835800-21835822 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363785 16:21835939-21835961 AGGGTGGAGCTGAGTGTGGAAGG + Intronic
1135363807 16:21836065-21836087 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363829 16:21836191-21836213 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363851 16:21836317-21836339 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363868 16:21836443-21836465 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363885 16:21836550-21836572 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363907 16:21836676-21836698 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363929 16:21836802-21836824 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363951 16:21836928-21836950 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363972 16:21837054-21837076 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363994 16:21837180-21837202 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135364017 16:21837318-21837340 AGGGTAGAGCTGAGGGTGGAAGG + Exonic
1135447824 16:22534030-22534052 AGGGTAGAGCTGAGGGTGGAAGG - Exonic
1135447847 16:22534168-22534190 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135447869 16:22534294-22534316 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135447890 16:22534420-22534442 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135447930 16:22534660-22534682 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135447947 16:22534764-22534786 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135447964 16:22534890-22534912 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135447986 16:22535016-22535038 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135448007 16:22535142-22535164 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135448029 16:22535268-22535290 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135448050 16:22535394-22535416 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135448096 16:22535659-22535681 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135448118 16:22535785-22535807 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135448140 16:22535911-22535933 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135620274 16:23949914-23949936 AGGGAAGAGGTGTGGGTGGCTGG - Intronic
1135779532 16:25288171-25288193 ATAGCAGTGGTGAGGGTGGATGG + Intergenic
1136037856 16:27554056-27554078 ATGGAAGAAGGGAGGGAGGAAGG + Intronic
1136083831 16:27870562-27870584 AGGGAAGAGAGGAGAGTGGAGGG - Intronic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1136307428 16:29381811-29381833 AGGTTGGAGCTGAGGGTGGAAGG + Exonic
1136307450 16:29381937-29381959 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307472 16:29382063-29382085 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307494 16:29382189-29382211 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307517 16:29382328-29382350 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307539 16:29382454-29382476 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307561 16:29382580-29382602 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307583 16:29382706-29382728 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307605 16:29382832-29382854 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307627 16:29382958-29382980 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307645 16:29383084-29383106 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307663 16:29383209-29383231 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307684 16:29383335-29383357 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307705 16:29383461-29383483 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307726 16:29383587-29383609 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307747 16:29383713-29383735 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307767 16:29383839-29383861 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307791 16:29383977-29383999 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136320974 16:29484141-29484163 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1136320995 16:29484267-29484289 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1136321017 16:29484393-29484415 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1136321042 16:29484532-29484554 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1136321064 16:29484658-29484680 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1136321086 16:29484784-29484806 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136321108 16:29484910-29484932 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136321123 16:29485036-29485058 AGAGTGGAGCTGAGGGTGGAAGG + Exonic
1136321140 16:29485143-29485165 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136321162 16:29485269-29485291 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136321186 16:29485407-29485429 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435547 16:30223481-30223503 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435568 16:30223607-30223629 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435590 16:30223733-30223755 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435612 16:30223859-30223881 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435634 16:30223985-30224007 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435654 16:30224111-30224133 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435679 16:30224250-30224272 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435701 16:30224376-30224398 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435723 16:30224502-30224524 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435738 16:30224628-30224650 AGAGTGGAGCTGAGGGTGGAAGG + Exonic
1136435755 16:30224735-30224757 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435777 16:30224861-30224883 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435799 16:30224987-30225009 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435821 16:30225113-30225135 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435843 16:30225239-30225261 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435867 16:30225377-30225399 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1137017863 16:35394362-35394384 TTGGGACAGCGGAGGGTGGAGGG - Intergenic
1137570906 16:49565847-49565869 ATGGAAAAGATAAGGATGGAAGG + Intronic
1137757294 16:50912898-50912920 ATGGATGAGCTGGGGTTGGAGGG - Intergenic
1137902463 16:52283652-52283674 AGGGAAGAGCTCAGTGTGGCTGG - Intergenic
1138327542 16:56188521-56188543 AGGGAATGGCTGAGGTTGGAGGG + Intergenic
1139015096 16:62680010-62680032 AAGAAAAGGCTGAGGGTGGATGG + Intergenic
1139380866 16:66529823-66529845 ATGGATGGGCAGAGGATGGATGG - Intronic
1139762528 16:69197299-69197321 ATGGAATAGGTGTGGGTGGTGGG + Intronic
1139855499 16:69976534-69976556 GTGGAAGAGGAGAGGGTGGAAGG + Intergenic
1139885217 16:70203652-70203674 GTGGAAGAGGAGAGGGTGGAAGG + Intergenic
1140058592 16:71547428-71547450 AGGGAAGAGGTGATGGTGGCAGG - Intronic
1140479873 16:75256798-75256820 AGGGGAGAGCTGAGAGAGGAGGG - Intronic
1140788754 16:78369018-78369040 AAGGAAGAGTTGAGAGAGGAAGG - Intronic
1141308726 16:82892079-82892101 AGGGATGAGCTGAGGTTGGAAGG - Intronic
1141345459 16:83240609-83240631 ATGAAAGAGAGGAGGGTTGAGGG + Intronic
1141721563 16:85758889-85758911 GTGGCAGAGCCGAGGGTGCATGG + Intergenic
1141842641 16:86583961-86583983 ATGGAAAGGATCAGGGTGGAAGG + Intergenic
1141993379 16:87622666-87622688 CAGGAGGAGCTGAGGGTGCATGG + Intronic
1142431487 16:90030722-90030744 CTGGGAGAGCTGAGGTGGGAGGG - Intronic
1142597109 17:1035305-1035327 ATGGAAGGAGTGAGGGAGGAAGG - Intronic
1143353121 17:6303923-6303945 ATCCCAGAGATGAGGGTGGAGGG + Intergenic
1143589025 17:7869232-7869254 ATGGAGGAGCTGAGACTTGAGGG + Intronic
1144262610 17:13537405-13537427 ATGGAGGAGCTGAGAAAGGAAGG - Intronic
1144535618 17:16087116-16087138 GTGGAACATCTGTGGGTGGATGG + Intronic
1144708170 17:17383759-17383781 CTGGAGGAGCTCAGGGTGGCCGG - Intergenic
1145980796 17:29010268-29010290 CAGGAAGAGCTCAGGGTAGATGG + Intronic
1146525809 17:33566076-33566098 AAGGGAGAGCTGAGTGAGGAGGG - Intronic
1146700610 17:34956429-34956451 ATGGAATCACTGAGGCTGGAGGG - Intronic
1147352813 17:39864950-39864972 AAAGTAGAGCTAAGGGTGGAAGG + Intergenic
1147378253 17:40035832-40035854 ATGTGAGACCTGGGGGTGGATGG - Intronic
1147650457 17:42058987-42059009 ATCTGAGAGCTGGGGGTGGAGGG - Intronic
1148675343 17:49441657-49441679 AGGGAAGAGAGGAAGGTGGAGGG + Intronic
1149572692 17:57684902-57684924 ATGGAAGAGCAGACGGGAGAGGG + Intergenic
1150429246 17:65102117-65102139 ATGGCAGAGCTGCAGGTGAATGG + Intergenic
1151342167 17:73478552-73478574 AGAGATGAGCTCAGGGTGGAGGG + Intronic
1151403417 17:73871111-73871133 ATGAAAGAGCTGAGGGAGGAAGG + Intergenic
1152270017 17:79319058-79319080 AGGGAAGACATGAGGGTGGGCGG + Intronic
1152289906 17:79434155-79434177 GTGTGAGAGCTGAGGCTGGAAGG + Intronic
1152328552 17:79657088-79657110 ATTGAAGGGCTTAGGGTGGAAGG - Intergenic
1152331249 17:79674582-79674604 ATTGATGAGCTGAGCTTGGAGGG - Intergenic
1152426547 17:80221275-80221297 CTGGGAGAGTTGAGGATGGAGGG + Intronic
1152492875 17:80649530-80649552 AAGGCAGAACTGTGGGTGGATGG + Intronic
1153238567 18:3011742-3011764 AGGGAAGAGCCGATGTTGGACGG + Exonic
1154494261 18:14944347-14944369 AGGGAAGAGCAGAGGGAGGGAGG - Intergenic
1155172036 18:23274255-23274277 ATGGGAGAGCTGAGGCTCAATGG + Intronic
1156073088 18:33237276-33237298 ATGGAAGTGCTGGGGGTGGAGGG - Intronic
1157563342 18:48663729-48663751 CTGGAAGAGATGGGGGTGAAAGG - Intronic
1157714823 18:49876847-49876869 ATGCTGGAGCAGAGGGTGGAGGG - Intronic
1158005304 18:52665227-52665249 ATCAAAGAGCTGAGGGCTGATGG + Intronic
1158021942 18:52853545-52853567 ATGGTAGAGGTGAGGTTGGGAGG + Intronic
1158888499 18:61851371-61851393 ATTGAAGAGGGGAGGGAGGACGG + Intronic
1159266694 18:66089520-66089542 ATGGAATTGCTGAAAGTGGAAGG + Intergenic
1159990299 18:74899314-74899336 ATGGAAGGGCAGAGAGTGGCAGG + Intronic
1160392649 18:78546907-78546929 ATGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160402466 18:78620945-78620967 ATGGAAGACCTGAGTGGTGATGG - Intergenic
1161406096 19:4092025-4092047 TTGGAAGGGCTGGGGGAGGAGGG + Intronic
1161484070 19:4525322-4525344 AGGGAAGAGCTGAGGATGGGAGG + Intronic
1161619501 19:5290808-5290830 ACGGGAGAGCTGTGGGTGGGGGG - Intronic
1162000580 19:7742532-7742554 AAGGAAGATGTGGGGGTGGAAGG + Exonic
1162132581 19:8536388-8536410 ATGGCATACCTGAGGGCGGAGGG + Exonic
1162185171 19:8898994-8899016 ATGGTAAAGTTGAGGGTGAACGG + Exonic
1162359572 19:10210440-10210462 TGGGAAGAGTTGAGGGAGGAAGG - Intronic
1163018188 19:14469605-14469627 AAGCAAGGCCTGAGGGTGGAGGG - Intronic
1163386105 19:17001512-17001534 AGGGAAGAACTTAGAGTGGAAGG + Intronic
1163609980 19:18295650-18295672 ATGGATGAGTGGATGGTGGATGG - Intergenic
1163609990 19:18295695-18295717 ATGGATGAGTGGATGGTGGATGG - Intergenic
1163610045 19:18295893-18295915 ATGGAAGGGTGGATGGTGGACGG - Intergenic
1163770728 19:19189536-19189558 AAGGAAGAGCCAGGGGTGGAGGG - Intronic
1164851482 19:31487905-31487927 TTGCAATAGCTGAAGGTGGAAGG - Intergenic
1164912365 19:32023313-32023335 AAGAAAGAGCAGAGGGGGGAGGG + Intergenic
1165112559 19:33510902-33510924 AGGGAAGAGCTGCAGGAGGAAGG - Intronic
1165160097 19:33810993-33811015 ATGGAAGGGCTCAGGGGGGCTGG + Intronic
1165461309 19:35945714-35945736 ATGGTAGAGGTGAGGCAGGAGGG + Exonic
1165610366 19:37146425-37146447 ATTTGAGAGCTGAGGGTGGAGGG + Intronic
1165744538 19:38222821-38222843 AGGGGAGAGGTGAGGCTGGAGGG - Intronic
1166687130 19:44802090-44802112 TTTGAAGATCTGAGGGTGGAGGG - Intergenic
1166713797 19:44953736-44953758 GTGGAGGAGCTGAGGGGGCAAGG + Intronic
1166734693 19:45077082-45077104 ATGGTGGAGCTGAGGCTGGAGGG + Intergenic
1166812190 19:45521332-45521354 TGGGAAGTGCTGGGGGTGGAGGG - Exonic
1166899725 19:46050170-46050192 AGGGAAGATCTGAGGCTGAAGGG - Intronic
1167019176 19:46861312-46861334 ATGGAGGAGCTGGAGGGGGAGGG + Intergenic
1167442173 19:49514619-49514641 ATGGGAGGGCTGAGTGTAGAAGG - Intronic
1167483401 19:49746461-49746483 ATCGAAGAGCTGAGGTGGGCGGG - Exonic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1168020673 19:53606643-53606665 GTGGAGGCGGTGAGGGTGGAGGG + Intergenic
1168116423 19:54223373-54223395 ATGGACGAGCTGAAGGAGGGAGG - Intronic
1168199722 19:54805810-54805832 CAGGAAGAGTTGGGGGTGGAGGG + Intronic
1168423006 19:56217529-56217551 CTGGAGGAGCTCAGGGTGGCCGG - Intergenic
1168521730 19:57056511-57056533 GGGGCAGACCTGAGGGTGGAGGG + Intergenic
925894416 2:8460322-8460344 ATGGAGCAGCGGGGGGTGGAGGG - Intergenic
926175598 2:10588921-10588943 ATGGAGGTGCAGAGGGTGGAGGG - Intronic
926355115 2:12034371-12034393 ATGGATGACCTGAGTGAGGACGG - Intergenic
926418672 2:12675725-12675747 CTGGCAGAGCAGAGGGTGGGAGG - Intergenic
929924670 2:46198306-46198328 ATGGAAAAGCTGAGGCAGGAAGG - Intergenic
930096281 2:47569531-47569553 ATAAAAGCGCCGAGGGTGGAGGG + Intronic
930625998 2:53698144-53698166 ATGCAAGAGCTGTGGGGGCATGG - Intronic
930780430 2:55219792-55219814 ATGGAGGAGCTGAGGTGGAATGG - Intronic
930859254 2:56052875-56052897 ATGGAAGAAGTGATGGTGGCAGG + Intergenic
931516758 2:63054611-63054633 ATGGAAGAGCGGAGATTGGCTGG + Intronic
931715796 2:65027676-65027698 ATGGAAGAGCTGAGCTTCCAGGG - Intergenic
932120046 2:69090391-69090413 ATGGAAGAGCTGGGAGCTGAGGG - Intronic
932401510 2:71483781-71483803 ATGGCAGAGCTGTGATTGGAAGG + Intronic
932451351 2:71812727-71812749 CTGGAAGAGCTGTAGGTGGGAGG + Intergenic
932822687 2:74914986-74915008 ATGGAAGTGATGAAGGTAGAGGG + Intergenic
933728743 2:85441186-85441208 ATCGAAGAGGGGAGGGTGGGAGG + Intergenic
934092956 2:88570350-88570372 CTGGAAGAGCTGGGGGAGCAGGG - Intronic
934559977 2:95308188-95308210 GGGGGAGAGCTGGGGGTGGACGG - Intronic
934951623 2:98579729-98579751 AAGGAAGAGGGCAGGGTGGAGGG - Intronic
935476351 2:103528228-103528250 AGAGAAGGGCTGAGGGTGGCTGG - Intergenic
935784139 2:106533625-106533647 AAGGAACAGGGGAGGGTGGAAGG + Intergenic
936160876 2:110083385-110083407 CTGCAACAGCTGTGGGTGGATGG + Intergenic
936183787 2:110287969-110287991 CTGCAACAGCTGTGGGTGGATGG - Intergenic
936233567 2:110724931-110724953 AAGGAAGAACGGAGGGAGGAAGG + Intergenic
937710665 2:124977033-124977055 ATGGAAGAGGCAAGGCTGGAAGG + Intergenic
938307159 2:130264068-130264090 TGGGAAGGGCTGAGTGTGGATGG + Intergenic
938546940 2:132342165-132342187 ATGGAGGAGAAGTGGGTGGAAGG - Intergenic
939178418 2:138778995-138779017 TTGCAAGTTCTGAGGGTGGAAGG - Intronic
939307262 2:140427394-140427416 AAGGACGAACGGAGGGTGGAAGG - Intronic
939733820 2:145819188-145819210 AAGGAAGGGATGAGGGAGGAAGG - Intergenic
940195428 2:151089147-151089169 AGGGAAGAGATGAGGGAGTAGGG - Intergenic
940216666 2:151310066-151310088 AAGGAGGAGTGGAGGGTGGAAGG - Intergenic
940645750 2:156391326-156391348 AAGGAAGAGATGAAGCTGGAAGG - Intergenic
940844035 2:158620371-158620393 ATGGAAGAGATGAGTTTGGCTGG + Intronic
940888351 2:159010964-159010986 TGTGAAGAGCTGAGGATGGAAGG + Intronic
940905012 2:159161082-159161104 ATGGAGCAGCTGAGGATGGCTGG - Intronic
941225171 2:162838949-162838971 AAGGAATGGCTGAGGGGGGATGG + Intergenic
942326578 2:174781403-174781425 ATGCCAGAGCTGAGAGTGGCAGG - Intergenic
942581360 2:177422127-177422149 CTGGAAGAGATGAGGCTGTAGGG + Intronic
944272893 2:197803988-197804010 GTGAAAGAGATGAGGGTGAAAGG - Intergenic
944925426 2:204459093-204459115 ATGGGAGAGGAGAGGGTGGGAGG - Intergenic
945663816 2:212717728-212717750 ATGGAAGAGCAGAGGCTCCAGGG - Intergenic
946336483 2:219040730-219040752 ATGGAAGAGATGAGAGATGATGG + Intronic
947047882 2:226008851-226008873 AAGGAAGAGCAGACGGAGGAGGG + Intergenic
947876520 2:233471268-233471290 CTGGAAGTGATGTGGGTGGAAGG + Exonic
947910790 2:233799523-233799545 ATGGAGCAGCCGAGGTTGGAAGG + Intronic
947968026 2:234298643-234298665 GATGAAGAGCTGAGTGTGGAAGG - Intergenic
948664497 2:239526655-239526677 CTGGAGGGGCTGAGGGTGAATGG - Intergenic
948815640 2:240509046-240509068 ATGGATGAGTGGAGGGTAGATGG + Intronic
948850643 2:240703775-240703797 AGGCAACAGCTGAGGGAGGAGGG + Intergenic
1168805099 20:667964-667986 TTGGAGGAGCTGGGAGTGGAGGG - Intronic
1169253089 20:4075127-4075149 CTGGAGGAGATGAGGATGGAGGG - Exonic
1169408936 20:5350523-5350545 AGGGAAGAGCTGAGGGGACAGGG - Intergenic
1169937736 20:10902910-10902932 AAGAAAGAGCTGAGGGTGGAGGG + Intergenic
1169941492 20:10942600-10942622 ATTGAAGAGCAGAGGGAGGAAGG - Intergenic
1170117584 20:12877124-12877146 ATGGAAAAGCAGGGGATGGAGGG + Intergenic
1171046339 20:21811681-21811703 ATGGAAGAGCAGGGGGTTGGGGG + Intergenic
1171214017 20:23339123-23339145 ATGGTAGAGAGGAGGGTGGAAGG - Intergenic
1171413690 20:24963340-24963362 ATGGAAGAGCAGAGGGAGCATGG - Exonic
1171516996 20:25746029-25746051 AGGGAAGAGCTGGGGGAGAAAGG - Intergenic
1171725794 20:28620147-28620169 ATGGAAGGGCAGCGCGTGGAGGG + Intergenic
1171752280 20:29062955-29062977 ATGGAAGGGCAGCGTGTGGAAGG - Intergenic
1171857717 20:30362211-30362233 ATGGAAGGGCAGCGCGTGGAGGG - Intergenic
1171875805 20:30574898-30574920 ATGGAGGAGAAGTGGGTGGAAGG - Intergenic
1172196233 20:33093503-33093525 ATGAATGAGTTGACGGTGGATGG - Intronic
1172196257 20:33093606-33093628 ATGGATGGGTTGATGGTGGATGG - Intronic
1172602829 20:36195595-36195617 GTGGGAGGGCTGAGGGAGGAGGG - Intronic
1172844611 20:37922518-37922540 AAGGCAGAGCTGAGGCTAGAGGG - Intronic
1172846982 20:37935443-37935465 AGGCAAGAGGTGAGGCTGGAGGG - Intronic
1172869250 20:38125667-38125689 AAGGAGGGGCAGAGGGTGGAAGG - Intronic
1172939531 20:38644907-38644929 AGGGAAGGACTGTGGGTGGATGG - Intronic
1173333112 20:42092082-42092104 GTGGAAGAGCTGAGAAGGGAGGG + Intronic
1173832433 20:46099770-46099792 CTGGAGGAGCTCAGGGTGGCCGG + Intergenic
1173878399 20:46391697-46391719 ATGGAAGAGAGGAAGGTTGAAGG - Intronic
1173972586 20:47164125-47164147 ATGGCAGCGCTGAGGGTCGTGGG + Intronic
1174051676 20:47771524-47771546 AGGGAAGAGCTGGGGGAGGTTGG - Intronic
1174692067 20:52516049-52516071 ATGGAAGGAGGGAGGGTGGAAGG + Intergenic
1174961073 20:55157788-55157810 AGGGAAGAGCTGCTGGTGGCAGG + Intergenic
1175385497 20:58592419-58592441 CTGGAAGTGCACAGGGTGGAAGG - Intergenic
1175716726 20:61259883-61259905 AAGTAAGAGCAAAGGGTGGAAGG - Intronic
1175934815 20:62509774-62509796 ATGGAGGGGTGGAGGGTGGAGGG - Intergenic
1175934869 20:62509923-62509945 ATGGAAGATGGAAGGGTGGAGGG - Intergenic
1175934945 20:62510123-62510145 ATGGAAGAGGGACGGGTGGAGGG - Intergenic
1175934969 20:62510200-62510222 CTGGAAGGGTGGAGGGTGGAGGG - Intergenic
1178057519 21:28815800-28815822 ATAGAAGAATTGAGGGAGGAAGG + Intergenic
1178127471 21:29530597-29530619 ATGGGAGAGGAGAGGGTTGAAGG + Intronic
1178935651 21:36859441-36859463 TGGGGAGAGCTGAGGGTGCAAGG - Intronic
1179874841 21:44262365-44262387 AAGAAAGGGATGAGGGTGGAGGG + Intergenic
1180390695 22:12279754-12279776 ATGGAAGGGCAGCGCGTGGAAGG + Intergenic
1180409048 22:12585003-12585025 ATGGAAGGGCAGCGCGTGGAAGG - Intergenic
1180708818 22:17825992-17826014 AGGGAAGAGCAGAGGATGGGCGG - Intronic
1181068262 22:20316684-20316706 AGGGCAGCACTGAGGGTGGAGGG - Intronic
1181270624 22:21656664-21656686 TTGGAAGAGCTGAGGGGTGGTGG + Intronic
1181826450 22:25520082-25520104 ATGGGAGAGTTGCGGGTGTAGGG - Intergenic
1182088051 22:27574965-27574987 GAGGAAGGGCTGAGGGTGGTGGG + Intergenic
1182351539 22:29702737-29702759 ATGGAAGCCCAGAGAGTGGAAGG - Intergenic
1182476448 22:30579141-30579163 CTGGAAGAGCAGAGGATGGAGGG - Exonic
1182619093 22:31608665-31608687 ATGGAGGAGCTTGGGGTGGTTGG + Intronic
1182842889 22:33406276-33406298 AGGGAAGACCTGCAGGTGGAGGG - Intronic
1183295264 22:37025442-37025464 CTTGGAGAACTGAGGGTGGAAGG + Intronic
1183717197 22:39540397-39540419 ATGGTAGAGCTGAGCGTGCAGGG + Intergenic
1183777831 22:39979107-39979129 TTGGAAGGGTTGAGGGTGGGAGG + Intergenic
1184131479 22:42519352-42519374 AGGTAAGAGCTGATGGGGGATGG + Intronic
1184141705 22:42581568-42581590 AGGTAAGAGCTGATGGGGGATGG + Intergenic
1184281829 22:43441836-43441858 ATGGAAGGTCTGAGGCTGCAGGG + Intronic
1184490948 22:44808541-44808563 CTGGTAGGGCGGAGGGTGGAGGG + Intronic
949861532 3:8509710-8509732 CTGGAAAATCTGAGGGTGGTTGG - Intronic
950101272 3:10358401-10358423 AGGGAAGAGCTCATGGTGGCTGG + Intronic
950110808 3:10417401-10417423 ATGGGTGAGCTGAGGATGGATGG + Intronic
950916509 3:16651280-16651302 ATAGAAGACATGAGGGTGGGTGG - Intronic
951559048 3:23947362-23947384 ATGGAAGAACTGAAGGGGGAAGG - Intronic
951584035 3:24196940-24196962 ATGGAAGTTTGGAGGGTGGATGG - Intronic
951866496 3:27314365-27314387 ATGTAAATGATGAGGGTGGAGGG + Intronic
953006256 3:38982090-38982112 CTGGAACACCTGAGGCTGGATGG - Intergenic
953567983 3:44049698-44049720 ATGTAAGAGCTAACGGTGGAAGG + Intergenic
954001970 3:47565036-47565058 ATGAAGGAGTTGAGGGTGGGAGG - Intronic
954684217 3:52361785-52361807 ATGGCAGATCTGAGGGAGTAAGG - Intronic
954692697 3:52404161-52404183 ATGGAGGAGATGTGGGTGGTGGG - Intronic
956939103 3:74136384-74136406 ATGGAAGAGCTGGTGGATGAAGG + Intergenic
957210420 3:77251218-77251240 ATGGAAGAGCTGTGGGGCCACGG - Intronic
957580570 3:82067316-82067338 GTAGAAGGGCTGAGGGTGGGAGG + Intergenic
958781110 3:98543440-98543462 ACTGAAGAGCAGAAGGTGGAAGG - Intronic
959087834 3:101869843-101869865 ATGGATGGGCTGTGGGTGGGTGG + Intergenic
959917954 3:111839162-111839184 CTGGAAGAGCTCAGTGTGGGTGG - Intronic
960079872 3:113530053-113530075 GTGGGAGAGCTGGGGGAGGAAGG + Intergenic
960123774 3:113975338-113975360 ATAGAAGAGCTGTGGATGAAAGG - Intronic
960589246 3:119349685-119349707 ATTGAAGAGGTCAGGGAGGAGGG - Intronic
960593850 3:119390751-119390773 ATGGAAGAGCTCAGTGTTGGAGG - Intronic
962028987 3:131579223-131579245 ATGGAAGAGCAAAGCCTGGATGG + Intronic
962754377 3:138456989-138457011 ATGGGAGAGCAGAGGGAGGGGGG - Intronic
962893377 3:139692467-139692489 ATGGGAAAGGTGAGGCTGGAGGG + Intergenic
963425067 3:145114211-145114233 ATGGAGGAATGGAGGGTGGAAGG - Intergenic
963456814 3:145555622-145555644 ATGGAGGAATGGAGGGTGGAAGG + Intergenic
964211722 3:154235796-154235818 GAAGAAGGGCTGAGGGTGGAAGG - Intronic
964648252 3:158981946-158981968 ATTGATGAGCTGATGGTGGATGG + Intronic
965822377 3:172697648-172697670 ACAAAAGAGCTGAGCGTGGAGGG + Intronic
967250587 3:187533979-187534001 TGGGGAGCGCTGAGGGTGGAGGG + Intergenic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
968614984 4:1573694-1573716 AGGGAAGAGCTGAGGGTGAGGGG - Intergenic
968615002 4:1573761-1573783 AGGGAGGAGCTGAGGGTGAGGGG - Intergenic
968615011 4:1573795-1573817 AGGGAGGAGCTGAGGGTGAGGGG - Intergenic
968615025 4:1573847-1573869 AGGGAGGAGCTGAGGGTGAGGGG - Intergenic
968615034 4:1573881-1573903 AGGGAGGAGCTGAGGGTGAGGGG - Intergenic
968615048 4:1573933-1573955 AGGGAGGAGCTGAGGGTGAGGGG - Intergenic
969358652 4:6647219-6647241 ATGGCAGGGCTTGGGGTGGAGGG + Intergenic
969654256 4:8487293-8487315 ATGGAGGAATGGAGGGTGGAAGG + Intronic
970604361 4:17665640-17665662 GGGGCAGAGCTGAGGCTGGAGGG + Intronic
971365959 4:25977409-25977431 ATGGAAGAGGAAAGGGTTGATGG + Intergenic
971966159 4:33558638-33558660 ATAGCATAGCTGAGGGTGGTGGG + Intergenic
972769277 4:42181434-42181456 ATGGAAGAGCTGAGCTTGGCAGG + Intergenic
972851231 4:43053263-43053285 ATGCAAGAGCTGTGGGGGCAGGG + Intergenic
974154099 4:58047977-58047999 ATGGGAGAGCAGAGTGTGGGAGG - Intergenic
974903630 4:68031862-68031884 ATGGAGGAATGGAGGGTGGAAGG - Intergenic
975170564 4:71227658-71227680 GTTGAAGAGCTGATGGTGGTGGG + Intronic
975355667 4:73400471-73400493 ATGGAAGATCTGGGGGCAGAGGG + Intronic
978459087 4:108930334-108930356 GTGGTAGGGCTGAGGGTGGAGGG - Intronic
979146473 4:117253349-117253371 AAGGAGGAGTGGAGGGTGGAAGG - Intergenic
979362413 4:119780368-119780390 AGGCTAGAGCTGAGGGTGGAAGG - Intergenic
979523077 4:121690416-121690438 AAGGAAGAGCTAAGAGTGAAAGG + Intronic
979723728 4:123934757-123934779 ATGAAAGAGTTGAGGGAGGTAGG - Intergenic
979932068 4:126643210-126643232 ATGGAGGAGCAGAGGGATGAGGG + Intergenic
980407548 4:132373227-132373249 ATGGTAGAGCAAAAGGTGGAAGG - Intergenic
980552340 4:134355513-134355535 ATGGAGGAGCTGAGAGTCGATGG + Intergenic
980608040 4:135119299-135119321 ATGAAAAAGCTGTGGTTGGAGGG + Intergenic
980842732 4:138285471-138285493 ATGGAAGAGGTGAGGATGAAAGG - Intergenic
980884057 4:138743014-138743036 ATGAAAGAGGTGAGGGAGAAGGG - Intergenic
981000367 4:139823365-139823387 ATGAAAGAGCTCAGGGTTGGAGG - Intronic
981178979 4:141716501-141716523 ATACAAGAGCTGAGGGGGCATGG + Intronic
982525182 4:156468503-156468525 ATTGAAGGGTAGAGGGTGGAAGG + Intergenic
982786430 4:159542614-159542636 ATGGAAGATTTGAGGATGAAGGG + Intergenic
983497825 4:168463430-168463452 ATTGGAGGGCGGAGGGTGGAGGG + Intronic
984582071 4:181521682-181521704 ATGGCAGTGCTGAGGGAGGAAGG - Intergenic
985057546 4:186048666-186048688 AAGGAGGAATTGAGGGTGGAAGG + Intergenic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
986706761 5:10459374-10459396 AGAGAAGTGATGAGGGTGGAAGG - Intronic
987629661 5:20452595-20452617 AGGGCAGATTTGAGGGTGGAGGG + Intronic
989233937 5:39122173-39122195 AGGGTAGAGCTGAGATTGGAAGG + Intronic
989311947 5:40029605-40029627 ATGGAAGAGGTTAGGATGCAAGG + Intergenic
989748830 5:44866297-44866319 ATGGGAGAGCAGAGGAAGGAGGG - Intergenic
989768052 5:45109635-45109657 ACAGAAGTGCTGAGAGTGGAGGG - Intergenic
990232870 5:53734048-53734070 CTGGAACTGCTGAGGGAGGATGG - Intergenic
990895757 5:60699152-60699174 ATGGAAGAGGTGAGGATGCTGGG - Intronic
990976902 5:61568510-61568532 AAGGAAGAGAGGAGGGGGGAAGG - Intergenic
991579589 5:68140496-68140518 AGGGAAGAGCTCAGAGTGGAGGG - Intergenic
992672213 5:79071654-79071676 ATCGAAGGGTGGAGGGTGGAAGG + Intronic
994162071 5:96567938-96567960 ATGGAGGAGGAGAGGGTGGCAGG + Intronic
994387972 5:99154668-99154690 ATTGGAGAGTGGAGGGTGGAAGG + Intergenic
995084272 5:108089339-108089361 AAGGAAGAGATTAGTGTGGATGG - Intronic
995129054 5:108610460-108610482 AAGGAAGAGGTGAAGGAGGAGGG + Intergenic
996527902 5:124498288-124498310 ATGGAGGAATGGAGGGTGGAAGG - Intergenic
996616703 5:125450626-125450648 ATTGAAGAGCAGAGGGAGGAAGG + Intergenic
997341016 5:133144668-133144690 AAGGAAGGCCTGAGGGTGGAGGG + Intergenic
997421003 5:133766667-133766689 CTGGAAGAGCTGGGTGTGGAGGG + Intergenic
997725989 5:136120232-136120254 AGGGAAGAGCTGGAGGTGCAGGG - Intergenic
997854213 5:137358534-137358556 AAGGAAGAGGGGAAGGTGGAGGG + Intronic
998267147 5:140674665-140674687 AGGGAAGAGGTGAGGGAGGTGGG - Exonic
999283069 5:150377451-150377473 CTGGAAGAGCTGAGAGAAGATGG + Intronic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
999530146 5:152454163-152454185 AGGGAAGAGCTGAGACTTGAAGG + Intergenic
999829247 5:155303428-155303450 ATGGAGGAACTGAGACTGGAGGG - Intergenic
1000294476 5:159901303-159901325 CTGGAAGAGCAAAGGGTGAAGGG - Intergenic
1000828045 5:166070538-166070560 TTGGAGGAGGTGAGGGTAGATGG - Intergenic
1000840511 5:166212208-166212230 ATGGTACAGCTGAGGATGGATGG - Intergenic
1001255852 5:170183108-170183130 CTGGAAGAGGCCAGGGTGGAGGG + Intergenic
1001651443 5:173318878-173318900 ATGGAAGAGCTGAAGTGGGAGGG + Intronic
1001759704 5:174197276-174197298 GTGGAGGAGCTGAGATTGGAGGG - Intronic
1001969152 5:175939677-175939699 TTGCAGGAGCTGTGGGTGGATGG - Intronic
1001972762 5:175969479-175969501 GGAGAAGAGCTGAGGGGGGAAGG + Intronic
1002244676 5:177874303-177874325 GGAGAAGAGCTGAGGGGGGAAGG - Intergenic
1002248288 5:177904066-177904088 TTGCAGGAGCTGTGGGTGGATGG + Intergenic
1003400294 6:5785108-5785130 AGGGAAGAGGTGAGGGGTGAAGG + Intergenic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1004632296 6:17433523-17433545 AGGGCAGAGGAGAGGGTGGAAGG + Intronic
1005103628 6:22200027-22200049 ACAGAGGAGCAGAGGGTGGAGGG - Intergenic
1006053219 6:31359464-31359486 AGGGAAGGGGTGAGGGTGGGAGG - Intergenic
1006370087 6:33638876-33638898 AAAGCAGAGCTGAGGGTGGAAGG + Intronic
1006756080 6:36416812-36416834 ATGGAAGAGCTGACTGTGGCTGG + Intronic
1007396659 6:41581821-41581843 ATGGAAGAGATGACCTTGGAAGG - Intronic
1007495856 6:42259947-42259969 CTGAAAGAGCTGGGGGTGGTAGG + Intronic
1007708039 6:43803469-43803491 AAAGAAGAGCTGTGGGTGGGTGG + Intergenic
1007803986 6:44423679-44423701 ATGTAAGCACTGAGGATGGATGG + Intronic
1007817124 6:44532426-44532448 GTGGCAGAGCTGAGGCTGGATGG + Intergenic
1007817831 6:44537227-44537249 ATGGCTGAGCTGAGAATGGAGGG - Intergenic
1007983625 6:46185305-46185327 CAGGCAGAGCTGAGGGAGGAAGG - Intergenic
1008670714 6:53765886-53765908 ATGGAAGGCATGAGGATGGAAGG - Intergenic
1008813864 6:55539697-55539719 ATGGAAGAGTTGAGGGGGGGAGG + Intronic
1010706944 6:79125840-79125862 AAGGAACAGCTGAGGGTGTGGGG + Intergenic
1011480670 6:87790583-87790605 GAGGAAGAGCTGAATGTGGAGGG + Intergenic
1011633128 6:89346495-89346517 ATAGAAAGGCTGAGAGTGGAGGG - Intronic
1013354716 6:109336635-109336657 ATGCCAGAACTGAGGGTGAATGG + Intergenic
1013652349 6:112208447-112208469 ATGGCAGGGGTGAGGGTGGCAGG - Intronic
1013891557 6:115033158-115033180 AGGGAAGAATGGAGGGTGGAAGG - Intergenic
1014844534 6:126258970-126258992 ATGGAAGGGTGGAGGGTGGGAGG - Intergenic
1015117100 6:129661799-129661821 TGGGATGGGCTGAGGGTGGAGGG - Intronic
1015128684 6:129785349-129785371 CTGGGTGAACTGAGGGTGGATGG + Intergenic
1015675793 6:135746955-135746977 ATGGAAAATATGAAGGTGGAGGG - Intergenic
1015685669 6:135856954-135856976 AAGGAAGAGAGGAGGGAGGAAGG - Intronic
1016562636 6:145414142-145414164 AAGGCAGAACTGAGTGTGGAAGG - Intergenic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017675337 6:156807240-156807262 GTGGAAGAGCCCAGGGTGAAGGG + Intronic
1018616587 6:165692400-165692422 ATGGTAGGGCAGAGGCTGGAGGG - Intronic
1018699633 6:166416293-166416315 ATGGTAGAGGTGATGGAGGAGGG - Intronic
1018699639 6:166416318-166416340 ATGGCAGAGATGATGGTGGAGGG - Intronic
1018883475 6:167909367-167909389 ATGGAGAAGGTGAGGATGGAGGG + Intronic
1020686119 7:11297732-11297754 ATGGAAGAGATGTGGCTGAAAGG + Intergenic
1021562570 7:21983364-21983386 ATGGAAGAGACGATGGTGAATGG - Intergenic
1021930978 7:25581134-25581156 TGGGAAGAGCAGATGGTGGAGGG - Intergenic
1022649194 7:32259319-32259341 AAAGAAGAGCTGATGATGGAAGG - Intronic
1022953066 7:35356596-35356618 ATGGCAGGGGTGAGGGTGGGTGG + Intergenic
1023806769 7:43877970-43877992 AGGGACGAGCTGAGGCTGCAGGG - Exonic
1023818986 7:43969906-43969928 CTGGTAGGGCTGAGGGTGGAGGG - Intergenic
1023842249 7:44104251-44104273 AAGGAGGAGCCGAGAGTGGACGG - Intergenic
1024108606 7:46120476-46120498 TTTGAAGGGCTGAGGTTGGAGGG + Intergenic
1024135757 7:46406459-46406481 AGAGAAGGGCAGAGGGTGGATGG - Intergenic
1024380953 7:48695317-48695339 AGGGAAGAGGGGAGGGAGGAAGG + Intergenic
1024522650 7:50319634-50319656 TTGGCAGCACTGAGGGTGGACGG + Intronic
1024569795 7:50714036-50714058 ATGGTAGAGGTGGTGGTGGAGGG - Intronic
1024841094 7:53588518-53588540 AGGGAAGAGCTAAGTGCGGATGG + Intergenic
1025753428 7:64312644-64312666 AGGGAAGGGCTGAGGGAGAAAGG + Intronic
1026881442 7:73909109-73909131 ATGGGAGAGGTCAGGGTGGGTGG + Intergenic
1027786851 7:82590735-82590757 GTGGAAGGGGTGAGGGTGGAGGG + Intergenic
1028622553 7:92841112-92841134 ATGGAAGAGCTGAGCGTGCAAGG - Intergenic
1028642096 7:93053842-93053864 AAGGAAGAGCTGGGAGGGGAAGG + Intergenic
1028968371 7:96827951-96827973 AGGGCAGAGCTGAGAGTGGGAGG + Intergenic
1029591184 7:101508071-101508093 GTGGAAGACATGAGGCTGGAGGG - Intronic
1029744039 7:102506869-102506891 CTGGTGGGGCTGAGGGTGGAGGG - Intronic
1029762029 7:102606032-102606054 CTGGTGGGGCTGAGGGTGGAGGG - Intronic
1029901389 7:104044054-104044076 ATGGCCTACCTGAGGGTGGAGGG + Intergenic
1030247688 7:107402702-107402724 CAGGAAGAGCTGCAGGTGGATGG + Intronic
1030792983 7:113752264-113752286 ATGGAAGAGCAAAGCGTGCAAGG + Intergenic
1031920940 7:127600165-127600187 AAGGAAGAGCTCAGGTTGGTGGG - Intronic
1032709406 7:134449094-134449116 ATGGAAGAGCTGGTGGATGAAGG - Exonic
1033305715 7:140223927-140223949 ACGGAGTGGCTGAGGGTGGAAGG - Intergenic
1033460087 7:141538917-141538939 ATGGATGAGCTGTGGATGGGAGG + Intergenic
1033595227 7:142854552-142854574 AAGGAAAAGCAGGGGGTGGAGGG - Intergenic
1033930870 7:146519335-146519357 AGGGAACAGATGAGGGAGGAAGG + Intronic
1034254999 7:149720056-149720078 CTGGAAGAGCTGTTGGGGGAGGG + Exonic
1034749686 7:153557218-153557240 ATGGCAGATCAGAGGGTGGTGGG + Intergenic
1035133239 7:156675238-156675260 AGGGGTGAGCTGAGGGTGGTCGG + Intronic
1036116726 8:5967448-5967470 AGGGAAGAGCTTAGGGGTGAAGG - Intergenic
1037587973 8:20290992-20291014 GTGGAGGAGCTGAGGGGAGAAGG - Intronic
1037751421 8:21684756-21684778 ATGGGTGAGTTGAGGGTGGCTGG + Intergenic
1037997877 8:23366834-23366856 AGGAAAGAGATAAGGGTGGAGGG - Intronic
1038192172 8:25333199-25333221 AAGCCAGAGGTGAGGGTGGAGGG + Intronic
1038399422 8:27271612-27271634 AAGGCAGAGCTGAGGTTAGAGGG - Intergenic
1038680091 8:29658778-29658800 ATGGAGGGGGTGAGGATGGAAGG - Intergenic
1038920674 8:32080578-32080600 TTGGAAGCTCTGAGAGTGGAAGG - Intronic
1039065974 8:33607804-33607826 AAGGAAGAGAGGAGGGAGGAGGG - Intergenic
1041424585 8:57705967-57705989 ACGAAAGAGCCGAGGGTGGAGGG + Intergenic
1041576177 8:59398218-59398240 GTGGAATACCAGAGGGTGGAAGG + Intergenic
1042601858 8:70506633-70506655 ATGGAGGAGTTAAGGGTGGTTGG - Intergenic
1043704996 8:83337735-83337757 AAGGAAGAGCTCAGGCTGAAAGG + Intergenic
1044304830 8:90627174-90627196 ATCCAAGTGCTGAGGGTGGTTGG + Intronic
1044755180 8:95454162-95454184 ATGTAGGAGTTGGGGGTGGAAGG - Intergenic
1044772869 8:95655677-95655699 ATGGAAGAGACGGGGGTGAATGG - Intergenic
1045011653 8:97964014-97964036 CTGGAAGATCTGAGTGTGGAAGG + Intronic
1045317132 8:101052864-101052886 ATGGCAGGGCAGAGGGAGGATGG - Intergenic
1045892129 8:107169752-107169774 ATGGTAGAGTGGAGGCTGGATGG + Intergenic
1046906933 8:119583379-119583401 ATGCAAGAGATGGAGGTGGAGGG + Intronic
1047631259 8:126711166-126711188 ATGGAAGAACTGGGGGAGAAAGG - Intergenic
1047691179 8:127356268-127356290 GTGTAAGAGCTGAGGCAGGAAGG + Intergenic
1047698422 8:127426800-127426822 AGGGAGGAGCTGGGGGAGGAGGG - Intergenic
1047930751 8:129726369-129726391 ATGGAAGAGGGGAGGCAGGAGGG + Intergenic
1048181789 8:132201936-132201958 ATGCAAGAGCTGTGGGGGCATGG - Intronic
1048209527 8:132443252-132443274 TTGGTAGTGCTGGGGGTGGAAGG - Intronic
1048448772 8:134513026-134513048 ATGGGGCAGCTGACGGTGGAAGG + Intronic
1048479584 8:134776295-134776317 AAGGAAAAGCTTAGGGTGGAGGG - Intergenic
1048855097 8:138680201-138680223 AAGGAAGAGATGTGGGAGGAAGG + Intronic
1049075731 8:140394854-140394876 CTCTAAGTGCTGAGGGTGGAGGG - Intronic
1049102219 8:140588009-140588031 ATGGAGGAGATGGGGGAGGATGG - Intronic
1049208945 8:141376499-141376521 AGGGAAGAGGTGAGGGAGGCTGG + Intergenic
1049350636 8:142162657-142162679 ATGGATGGGCAGAGGATGGATGG + Intergenic
1049350714 8:142163098-142163120 ATGGATGAACAGAGGATGGATGG + Intergenic
1049350789 8:142163494-142163516 ATGGATGAACAGAGGATGGATGG + Intergenic
1049350903 8:142164107-142164129 ATGGATGAACAGAGGATGGATGG + Intergenic
1049364269 8:142229156-142229178 ATGGATGAATGGAGGGTGGATGG + Intronic
1049416981 8:142499761-142499783 ATGGAATAGCTGGGGGTAGCGGG + Intronic
1049610085 8:143550868-143550890 ATGGAATAGCTGTCAGTGGAGGG - Intergenic
1049868970 8:144958745-144958767 ATGGAGGAATGGAGGGTGGAAGG + Intergenic
1050361463 9:4835177-4835199 AGTGAAGAGCTGAAGGTGGCTGG + Intronic
1051756337 9:20404931-20404953 ATGGAGGATCTGAGGAAGGAAGG - Intronic
1052971906 9:34381642-34381664 TAGGAAGGGCTGAAGGTGGATGG + Intronic
1053123233 9:35561112-35561134 ACGGAAGGGCTGAGGGGGGCGGG + Intronic
1053355484 9:37442028-37442050 ATGGAAGAGCTCATGGGGGCTGG + Exonic
1053723815 9:40975721-40975743 ATGGAAGGGCAGCGCGTGGAGGG - Intergenic
1054877647 9:70113228-70113250 AGGGAAGAGAGGAGGGAGGAGGG + Intronic
1055372126 9:75611477-75611499 ATAGTAGAGGTGAGGGTTGAAGG - Intergenic
1055807585 9:80114169-80114191 AGGGATCAGCTGAAGGTGGAAGG + Intergenic
1056777614 9:89525188-89525210 ATGGAAGAGCTCAGGCTGATTGG + Intergenic
1057130598 9:92651662-92651684 AGGGAGGAGCTGGAGGTGGAGGG - Intronic
1057423890 9:94933326-94933348 ATGGAAGAGCTAAGGTGGCAGGG + Intronic
1057488724 9:95506406-95506428 GTGGAGGAGCTGTGGGTGGAAGG - Exonic
1057981931 9:99671425-99671447 ATGGAGGAATGGAGGGTGGAAGG - Intergenic
1058578201 9:106425864-106425886 TTGGTAGAGCTGGGGGAGGATGG + Intergenic
1058944228 9:109841688-109841710 AGGGAAGAGGAGAGGATGGAGGG + Intronic
1058944313 9:109841923-109841945 AGGGTAGAGGGGAGGGTGGAAGG + Intronic
1059726601 9:117014506-117014528 AGGAAAGAGCTGGGAGTGGAAGG - Intronic
1060206405 9:121685143-121685165 ATGGAGGGAGTGAGGGTGGAGGG - Intronic
1060506664 9:124202925-124202947 CTGGAAGGGGTGAGGGAGGAAGG + Intergenic
1061207884 9:129174948-129174970 AGGGAAGAGCGGCGGGTGGGAGG + Intergenic
1061257197 9:129459946-129459968 ATGGAAAAACTGAGGCTGGGAGG - Intergenic
1061318979 9:129815886-129815908 GTGGAAGCGGTGGGGGTGGAGGG - Intronic
1061598281 9:131646936-131646958 CTGGAAGAGCTGAAGGGGAAAGG + Intronic
1061938412 9:133871308-133871330 ATGGATGAATTGGGGGTGGATGG + Intronic
1062171896 9:135139377-135139399 ATGGCAGAGCAGATGCTGGAAGG - Intergenic
1062246683 9:135572088-135572110 ATGGAAGGGTTGTGGATGGATGG + Intergenic
1062248056 9:135579859-135579881 ATGGAAGGGTGGATGGTGGATGG - Intergenic
1062391657 9:136336317-136336339 GCGGCAGAACTGAGGGTGGAAGG - Intronic
1186698622 X:12065526-12065548 ATGGAAGTGGAGAGGGAGGAAGG - Intergenic
1187195237 X:17077418-17077440 ATGGAAGGGCTCAGGGGGCAAGG - Intronic
1187245424 X:17549413-17549435 ATGGTAGTGGGGAGGGTGGAGGG - Intronic
1187282461 X:17868241-17868263 ATGGACACGCTGAGGGTGGTAGG - Intergenic
1187334764 X:18372533-18372555 ATGCAAGAGCTGTGGGGGCATGG + Intergenic
1187378698 X:18780746-18780768 ATGGGAGAGCTGAAAGAGGAGGG + Intronic
1188484548 X:30668852-30668874 ATGGAAGTCCTGAGAGAGGATGG + Intronic
1189230769 X:39450895-39450917 ATGGAGGAGGGGAGAGTGGAGGG - Intergenic
1189236236 X:39489450-39489472 ATGGGAAAGCTGATGATGGAGGG - Intergenic
1189303896 X:39972495-39972517 ATGGGAGAGTTCAGGCTGGAAGG + Intergenic
1189895044 X:45646680-45646702 ATGGAAGAGCAGAGAGTAAAGGG - Intergenic
1192269703 X:69567139-69567161 ATTGAAGCCATGAGGGTGGACGG + Intergenic
1192449558 X:71235424-71235446 GTGGAAAGGCTGAGGGTGGTGGG - Intergenic
1192687602 X:73323406-73323428 ATGGCAGGACTGAGAGTGGATGG - Intergenic
1192729714 X:73790886-73790908 ATTGAAGAGCTGAGGGTGCAGGG - Intergenic
1193000241 X:76555328-76555350 TTGGAATAGCCCAGGGTGGAGGG + Intergenic
1194565129 X:95477234-95477256 ATTGGAGAGTGGAGGGTGGAAGG + Intergenic
1194657665 X:96592869-96592891 GGGTAAGACCTGAGGGTGGAAGG - Intergenic
1195993589 X:110708770-110708792 TTGAAAGAGCAGAGTGTGGATGG - Intronic
1196209559 X:112980765-112980787 AGGGAAGAGCTGATTGAGGAGGG - Intergenic
1196316852 X:114237038-114237060 ATGGAAGATTTGAAGGTGGGTGG - Intergenic
1196736469 X:118985197-118985219 ATGAAAGGGCAGAGGGTGGTGGG - Intronic
1197436156 X:126430701-126430723 ATGGAAGAGCTGTGGGGGCATGG + Intergenic
1198598309 X:138260045-138260067 AAGGAAGAATGGAGGGTGGAAGG - Intergenic
1199012804 X:142777387-142777409 ATGGAAGAGCAGAAGGCTGAGGG + Intergenic
1199377779 X:147133586-147133608 AGGGAGGAGTGGAGGGTGGAAGG + Intergenic
1199554874 X:149095927-149095949 GTGGAAGAGCTGATGGTTGTAGG + Intergenic
1199767311 X:150950473-150950495 ATGGAAGGGCAGAGGATAGAGGG + Intergenic
1200884178 Y:8252484-8252506 AGGGAAGCGCTGTGGGTAGAAGG - Intergenic
1201346000 Y:12985411-12985433 AGGGAACAGCTGTGGGGGGATGG - Intergenic