ID: 1114402305

View in Genome Browser
Species Human (GRCh38)
Location 14:22421056-22421078
Sequence CTGCAGAAGCAGAAGGACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114402305_1114402309 1 Left 1114402305 14:22421056-22421078 CCATAGTCCTTCTGCTTCTGCAG No data
Right 1114402309 14:22421080-22421102 ATATTTATAGCTGCAATGGAGGG No data
1114402305_1114402308 0 Left 1114402305 14:22421056-22421078 CCATAGTCCTTCTGCTTCTGCAG No data
Right 1114402308 14:22421079-22421101 AATATTTATAGCTGCAATGGAGG No data
1114402305_1114402307 -3 Left 1114402305 14:22421056-22421078 CCATAGTCCTTCTGCTTCTGCAG No data
Right 1114402307 14:22421076-22421098 CAGAATATTTATAGCTGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114402305 Original CRISPR CTGCAGAAGCAGAAGGACTA TGG (reversed) Intergenic
No off target data available for this crispr