ID: 1114405346

View in Genome Browser
Species Human (GRCh38)
Location 14:22451177-22451199
Sequence TGAGTGCCAAAGTCCCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114405346_1114405353 29 Left 1114405346 14:22451177-22451199 CCTGGCTGGGACTTTGGCACTCA No data
Right 1114405353 14:22451229-22451251 CTAGAGAGATAGGGTGGTGATGG No data
1114405346_1114405348 -6 Left 1114405346 14:22451177-22451199 CCTGGCTGGGACTTTGGCACTCA No data
Right 1114405348 14:22451194-22451216 CACTCAGCTCAGGTTTTTCAAGG No data
1114405346_1114405349 4 Left 1114405346 14:22451177-22451199 CCTGGCTGGGACTTTGGCACTCA No data
Right 1114405349 14:22451204-22451226 AGGTTTTTCAAGGTAAAAGAAGG No data
1114405346_1114405350 19 Left 1114405346 14:22451177-22451199 CCTGGCTGGGACTTTGGCACTCA No data
Right 1114405350 14:22451219-22451241 AAAGAAGGCTCTAGAGAGATAGG No data
1114405346_1114405351 20 Left 1114405346 14:22451177-22451199 CCTGGCTGGGACTTTGGCACTCA No data
Right 1114405351 14:22451220-22451242 AAGAAGGCTCTAGAGAGATAGGG No data
1114405346_1114405352 23 Left 1114405346 14:22451177-22451199 CCTGGCTGGGACTTTGGCACTCA No data
Right 1114405352 14:22451223-22451245 AAGGCTCTAGAGAGATAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114405346 Original CRISPR TGAGTGCCAAAGTCCCAGCC AGG (reversed) Intergenic
No off target data available for this crispr