ID: 1114408472

View in Genome Browser
Species Human (GRCh38)
Location 14:22478360-22478382
Sequence AGTGAGGGGATTATGTCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114408468_1114408472 -4 Left 1114408468 14:22478341-22478363 CCAGAGCTAAAAGCTTTTCAGTG No data
Right 1114408472 14:22478360-22478382 AGTGAGGGGATTATGTCTAGAGG No data
1114408467_1114408472 25 Left 1114408467 14:22478312-22478334 CCTGGAGTTTAATTCTTGGCACT No data
Right 1114408472 14:22478360-22478382 AGTGAGGGGATTATGTCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114408472 Original CRISPR AGTGAGGGGATTATGTCTAG AGG Intergenic