ID: 1114408473

View in Genome Browser
Species Human (GRCh38)
Location 14:22478361-22478383
Sequence GTGAGGGGATTATGTCTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114408468_1114408473 -3 Left 1114408468 14:22478341-22478363 CCAGAGCTAAAAGCTTTTCAGTG No data
Right 1114408473 14:22478361-22478383 GTGAGGGGATTATGTCTAGAGGG No data
1114408467_1114408473 26 Left 1114408467 14:22478312-22478334 CCTGGAGTTTAATTCTTGGCACT No data
Right 1114408473 14:22478361-22478383 GTGAGGGGATTATGTCTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114408473 Original CRISPR GTGAGGGGATTATGTCTAGA GGG Intergenic