ID: 1114408475

View in Genome Browser
Species Human (GRCh38)
Location 14:22478389-22478411
Sequence CCCTGATGCTCTAGTCTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114408468_1114408475 25 Left 1114408468 14:22478341-22478363 CCAGAGCTAAAAGCTTTTCAGTG No data
Right 1114408475 14:22478389-22478411 CCCTGATGCTCTAGTCTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114408475 Original CRISPR CCCTGATGCTCTAGTCTCTA AGG Intergenic