ID: 1114408990

View in Genome Browser
Species Human (GRCh38)
Location 14:22483130-22483152
Sequence CCTAAGCTGGAATGTTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114408990_1114408999 5 Left 1114408990 14:22483130-22483152 CCTCCAAAACATTCCAGCTTAGG No data
Right 1114408999 14:22483158-22483180 AATCTAATGTTTGTGCTGGGGGG No data
1114408990_1114408994 1 Left 1114408990 14:22483130-22483152 CCTCCAAAACATTCCAGCTTAGG No data
Right 1114408994 14:22483154-22483176 TCCAAATCTAATGTTTGTGCTGG No data
1114408990_1114409000 11 Left 1114408990 14:22483130-22483152 CCTCCAAAACATTCCAGCTTAGG No data
Right 1114409000 14:22483164-22483186 ATGTTTGTGCTGGGGGGATATGG No data
1114408990_1114408997 3 Left 1114408990 14:22483130-22483152 CCTCCAAAACATTCCAGCTTAGG No data
Right 1114408997 14:22483156-22483178 CAAATCTAATGTTTGTGCTGGGG No data
1114408990_1114408998 4 Left 1114408990 14:22483130-22483152 CCTCCAAAACATTCCAGCTTAGG No data
Right 1114408998 14:22483157-22483179 AAATCTAATGTTTGTGCTGGGGG No data
1114408990_1114408996 2 Left 1114408990 14:22483130-22483152 CCTCCAAAACATTCCAGCTTAGG No data
Right 1114408996 14:22483155-22483177 CCAAATCTAATGTTTGTGCTGGG No data
1114408990_1114409001 24 Left 1114408990 14:22483130-22483152 CCTCCAAAACATTCCAGCTTAGG No data
Right 1114409001 14:22483177-22483199 GGGGATATGGTGCCCATCAGAGG No data
1114408990_1114409002 25 Left 1114408990 14:22483130-22483152 CCTCCAAAACATTCCAGCTTAGG No data
Right 1114409002 14:22483178-22483200 GGGATATGGTGCCCATCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114408990 Original CRISPR CCTAAGCTGGAATGTTTTGG AGG (reversed) Intergenic
No off target data available for this crispr