ID: 1114409351

View in Genome Browser
Species Human (GRCh38)
Location 14:22486130-22486152
Sequence GGGAGAATAAACTCACCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114409351_1114409353 -5 Left 1114409351 14:22486130-22486152 CCTTTGGGTGAGTTTATTCTCCC No data
Right 1114409353 14:22486148-22486170 CTCCCCAGAATTAAAAGAGGAGG No data
1114409351_1114409358 26 Left 1114409351 14:22486130-22486152 CCTTTGGGTGAGTTTATTCTCCC No data
Right 1114409358 14:22486179-22486201 GAGCTTCAGAAGTCCCCCTAGGG No data
1114409351_1114409352 -8 Left 1114409351 14:22486130-22486152 CCTTTGGGTGAGTTTATTCTCCC No data
Right 1114409352 14:22486145-22486167 ATTCTCCCCAGAATTAAAAGAGG No data
1114409351_1114409357 25 Left 1114409351 14:22486130-22486152 CCTTTGGGTGAGTTTATTCTCCC No data
Right 1114409357 14:22486178-22486200 CGAGCTTCAGAAGTCCCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114409351 Original CRISPR GGGAGAATAAACTCACCCAA AGG (reversed) Intergenic
No off target data available for this crispr