ID: 1114409353

View in Genome Browser
Species Human (GRCh38)
Location 14:22486148-22486170
Sequence CTCCCCAGAATTAAAAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114409351_1114409353 -5 Left 1114409351 14:22486130-22486152 CCTTTGGGTGAGTTTATTCTCCC No data
Right 1114409353 14:22486148-22486170 CTCCCCAGAATTAAAAGAGGAGG No data
1114409348_1114409353 2 Left 1114409348 14:22486123-22486145 CCAGGCCCCTTTGGGTGAGTTTA No data
Right 1114409353 14:22486148-22486170 CTCCCCAGAATTAAAAGAGGAGG No data
1114409347_1114409353 3 Left 1114409347 14:22486122-22486144 CCCAGGCCCCTTTGGGTGAGTTT No data
Right 1114409353 14:22486148-22486170 CTCCCCAGAATTAAAAGAGGAGG No data
1114409350_1114409353 -4 Left 1114409350 14:22486129-22486151 CCCTTTGGGTGAGTTTATTCTCC No data
Right 1114409353 14:22486148-22486170 CTCCCCAGAATTAAAAGAGGAGG No data
1114409344_1114409353 12 Left 1114409344 14:22486113-22486135 CCTCACAGACCCAGGCCCCTTTG No data
Right 1114409353 14:22486148-22486170 CTCCCCAGAATTAAAAGAGGAGG No data
1114409349_1114409353 -3 Left 1114409349 14:22486128-22486150 CCCCTTTGGGTGAGTTTATTCTC No data
Right 1114409353 14:22486148-22486170 CTCCCCAGAATTAAAAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114409353 Original CRISPR CTCCCCAGAATTAAAAGAGG AGG Intergenic
No off target data available for this crispr