ID: 1114409357

View in Genome Browser
Species Human (GRCh38)
Location 14:22486178-22486200
Sequence CGAGCTTCAGAAGTCCCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114409351_1114409357 25 Left 1114409351 14:22486130-22486152 CCTTTGGGTGAGTTTATTCTCCC No data
Right 1114409357 14:22486178-22486200 CGAGCTTCAGAAGTCCCCCTAGG No data
1114409355_1114409357 4 Left 1114409355 14:22486151-22486173 CCCAGAATTAAAAGAGGAGGAAG No data
Right 1114409357 14:22486178-22486200 CGAGCTTCAGAAGTCCCCCTAGG No data
1114409354_1114409357 5 Left 1114409354 14:22486150-22486172 CCCCAGAATTAAAAGAGGAGGAA No data
Right 1114409357 14:22486178-22486200 CGAGCTTCAGAAGTCCCCCTAGG No data
1114409349_1114409357 27 Left 1114409349 14:22486128-22486150 CCCCTTTGGGTGAGTTTATTCTC No data
Right 1114409357 14:22486178-22486200 CGAGCTTCAGAAGTCCCCCTAGG No data
1114409350_1114409357 26 Left 1114409350 14:22486129-22486151 CCCTTTGGGTGAGTTTATTCTCC No data
Right 1114409357 14:22486178-22486200 CGAGCTTCAGAAGTCCCCCTAGG No data
1114409356_1114409357 3 Left 1114409356 14:22486152-22486174 CCAGAATTAAAAGAGGAGGAAGT No data
Right 1114409357 14:22486178-22486200 CGAGCTTCAGAAGTCCCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114409357 Original CRISPR CGAGCTTCAGAAGTCCCCCT AGG Intergenic
No off target data available for this crispr