ID: 1114411480

View in Genome Browser
Species Human (GRCh38)
Location 14:22504653-22504675
Sequence TCTCACTCTGTCGCGCACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114411480_1114411483 8 Left 1114411480 14:22504653-22504675 CCAGCGTGCGCGACAGAGTGAGA No data
Right 1114411483 14:22504684-22504706 CAAAAAAAGAAGAAGGAAGCTGG No data
1114411480_1114411481 1 Left 1114411480 14:22504653-22504675 CCAGCGTGCGCGACAGAGTGAGA No data
Right 1114411481 14:22504677-22504699 TCCATCTCAAAAAAAGAAGAAGG No data
1114411480_1114411484 9 Left 1114411480 14:22504653-22504675 CCAGCGTGCGCGACAGAGTGAGA No data
Right 1114411484 14:22504685-22504707 AAAAAAAGAAGAAGGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114411480 Original CRISPR TCTCACTCTGTCGCGCACGC TGG (reversed) Intergenic
No off target data available for this crispr