ID: 1114416452

View in Genome Browser
Species Human (GRCh38)
Location 14:22548043-22548065
Sequence CAGTCTGAGCAAAGGCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114416452_1114416455 1 Left 1114416452 14:22548043-22548065 CCTGCCTGCCTTTGCTCAGACTG No data
Right 1114416455 14:22548067-22548089 TTGCCCCTTACTGCTCTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114416452 Original CRISPR CAGTCTGAGCAAAGGCAGGC AGG (reversed) Intergenic
No off target data available for this crispr