ID: 1114417121

View in Genome Browser
Species Human (GRCh38)
Location 14:22552385-22552407
Sequence CCCGTGGCGTGGCATGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114417121_1114417134 24 Left 1114417121 14:22552385-22552407 CCACTCTCATGCCACGCCACGGG No data
Right 1114417134 14:22552432-22552454 ACATGGGTGGCAGTGACCTGCGG No data
1114417121_1114417131 11 Left 1114417121 14:22552385-22552407 CCACTCTCATGCCACGCCACGGG No data
Right 1114417131 14:22552419-22552441 CAGGAGCCCACACACATGGGTGG No data
1114417121_1114417130 8 Left 1114417121 14:22552385-22552407 CCACTCTCATGCCACGCCACGGG No data
Right 1114417130 14:22552416-22552438 TAACAGGAGCCCACACACATGGG No data
1114417121_1114417124 -8 Left 1114417121 14:22552385-22552407 CCACTCTCATGCCACGCCACGGG No data
Right 1114417124 14:22552400-22552422 GCCACGGGACCACCCATAACAGG No data
1114417121_1114417129 7 Left 1114417121 14:22552385-22552407 CCACTCTCATGCCACGCCACGGG No data
Right 1114417129 14:22552415-22552437 ATAACAGGAGCCCACACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114417121 Original CRISPR CCCGTGGCGTGGCATGAGAG TGG (reversed) Intergenic
No off target data available for this crispr