ID: 1114418078

View in Genome Browser
Species Human (GRCh38)
Location 14:22557317-22557339
Sequence CCAGGCCCTCCTCTCCTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 301}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114418078_1114418090 -2 Left 1114418078 14:22557317-22557339 CCCCAAAGGAGAGGAGGGCCTGG 0: 1
1: 0
2: 0
3: 33
4: 301
Right 1114418090 14:22557338-22557360 GGGGCCTGGGCCGGCAGCAGGGG 0: 1
1: 0
2: 4
3: 97
4: 959
1114418078_1114418091 -1 Left 1114418078 14:22557317-22557339 CCCCAAAGGAGAGGAGGGCCTGG 0: 1
1: 0
2: 0
3: 33
4: 301
Right 1114418091 14:22557339-22557361 GGGCCTGGGCCGGCAGCAGGGGG 0: 1
1: 0
2: 5
3: 76
4: 832
1114418078_1114418089 -3 Left 1114418078 14:22557317-22557339 CCCCAAAGGAGAGGAGGGCCTGG 0: 1
1: 0
2: 0
3: 33
4: 301
Right 1114418089 14:22557337-22557359 TGGGGCCTGGGCCGGCAGCAGGG 0: 1
1: 0
2: 5
3: 57
4: 549
1114418078_1114418088 -4 Left 1114418078 14:22557317-22557339 CCCCAAAGGAGAGGAGGGCCTGG 0: 1
1: 0
2: 0
3: 33
4: 301
Right 1114418088 14:22557336-22557358 CTGGGGCCTGGGCCGGCAGCAGG 0: 2
1: 1
2: 9
3: 84
4: 793
1114418078_1114418094 13 Left 1114418078 14:22557317-22557339 CCCCAAAGGAGAGGAGGGCCTGG 0: 1
1: 0
2: 0
3: 33
4: 301
Right 1114418094 14:22557353-22557375 AGCAGGGGGCGCTGTTCGTCCGG 0: 1
1: 1
2: 58
3: 384
4: 620
1114418078_1114418095 14 Left 1114418078 14:22557317-22557339 CCCCAAAGGAGAGGAGGGCCTGG 0: 1
1: 0
2: 0
3: 33
4: 301
Right 1114418095 14:22557354-22557376 GCAGGGGGCGCTGTTCGTCCGGG 0: 1
1: 0
2: 8
3: 87
4: 484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114418078 Original CRISPR CCAGGCCCTCCTCTCCTTTG GGG (reversed) Intronic
900331315 1:2136057-2136079 CCAGGGCCACCGCTCCTGTGAGG - Intronic
900338175 1:2175152-2175174 CCATGACCCCCTCTCCTTGGTGG - Intronic
900741740 1:4334314-4334336 CCAGGCTTTCCTCTTCCTTGTGG + Intergenic
901144695 1:7057055-7057077 CCAGGCCCTTCTCTCGGGTGGGG + Intronic
901604901 1:10451469-10451491 CCCGGGCTTCCTCTCCTATGAGG - Exonic
902329777 1:15725562-15725584 CCAGGACCTCAGCTCCTTTCTGG - Intronic
902717611 1:18283306-18283328 GCAGTCCCTGCTCTCCCTTGTGG - Intronic
902936507 1:19768636-19768658 CCAGGCCAGCCTCTGCTTTGAGG - Intronic
902955397 1:19921672-19921694 CCAGGCCCTGCCCTTCTTTCAGG + Intronic
903710101 1:25317009-25317031 CCAGGTCCTCCTCAGCATTGGGG + Intronic
903717015 1:25375397-25375419 CCAGGTCCTCCTCAGCATTGGGG - Exonic
904458652 1:30662494-30662516 TGAGGCCCTCCTCTCCTTGCAGG - Intergenic
904493469 1:30874189-30874211 CCACGCCCTGATCTCCTTTCTGG + Intronic
904603062 1:31684135-31684157 CGGGGCCCTGCTCTCCTTTGGGG + Exonic
906141790 1:43538194-43538216 CCAGGGCCTCCACTCCTTCCTGG - Exonic
906612519 1:47213250-47213272 CCAAGTCATCCTCTCCATTGTGG - Intergenic
906636656 1:47415023-47415045 CCAGGGCCTCCTTACATTTGGGG - Intergenic
907045251 1:51296648-51296670 CCAGGCCCTGCTCACGTTTCTGG - Intronic
908252896 1:62279104-62279126 ACTTGCCCTCCTCTCCCTTGTGG - Intronic
910866163 1:91789960-91789982 TCAGGCCCTCCAATCCTATGTGG + Intronic
911290441 1:96051055-96051077 CCAGGCCCACCTTTCCTTTAGGG + Intergenic
914279122 1:146153745-146153767 CCAGGCACTATTCCCCTTTGTGG + Intronic
915459492 1:156061278-156061300 CCTGCCCCTCCTCTCATTGGGGG - Exonic
916060604 1:161096089-161096111 CCAGTCCCTGCTCTCATTTCTGG + Intergenic
916126593 1:161576817-161576839 CCAGGCTTCCCTCTCCTTTGGGG + Intergenic
916136512 1:161658657-161658679 CCAGGCTTCCCTCTCCTTTGGGG + Intronic
916845984 1:168650527-168650549 CCTTGCCCTACTCTCCTTTGTGG + Intergenic
917671785 1:177280439-177280461 CCAGTCCCTCCTCTACTGTGGGG + Exonic
917834709 1:178932114-178932136 CCACGCCCTCAGCTCCCTTGGGG + Intergenic
919718964 1:200811185-200811207 CCAAGCCCTCCTCTACTTGGTGG + Intronic
919744501 1:201000149-201000171 TCAGTCCTTCCTCTCCTTGGGGG + Intronic
922111391 1:222560074-222560096 CCAGGCCCATTTCTCCTTGGAGG - Intronic
922724872 1:227918124-227918146 CCAGGTCCTCCTCTTCTTCAGGG + Intergenic
922730183 1:227945515-227945537 CCAGGCCAGCCTCTCCTCTCCGG + Intronic
1064532926 10:16328785-16328807 CTAGGACCTCCTCTTCTTTGTGG - Intergenic
1065240054 10:23695453-23695475 CCAGTCCCTCCTCCCAGTTGGGG - Intronic
1066654350 10:37684791-37684813 CCAGGCCCTCTGCTCCCTTGTGG + Intergenic
1069643366 10:69971572-69971594 CCAGGCCCTGCTCACCAGTGAGG + Intergenic
1071589800 10:86862186-86862208 CCTAGCACTCCTCTCCTTTCTGG - Intronic
1073260685 10:102188235-102188257 CCAGGGCCTCCTCTCTGCTGAGG - Intergenic
1074866396 10:117546598-117546620 CCAGGCCCTCCTCGGTTTTGGGG - Intronic
1075066744 10:119293985-119294007 CCACCCCCACCTCTGCTTTGTGG + Intronic
1076703791 10:132290165-132290187 CCCAGCCCTGCTCTCCTTTCTGG - Intronic
1076766383 10:132636585-132636607 CCAGTCGCTCCTGTCCCTTGGGG + Intronic
1077167363 11:1149862-1149884 CCAGGGCCTCCTTCCTTTTGGGG + Intergenic
1078200811 11:9181066-9181088 CCAGGCTAACCTCTGCTTTGTGG - Exonic
1078446247 11:11407184-11407206 TCAGGCACTCCTCCCCTTTACGG - Intronic
1078570318 11:12452331-12452353 AAATGCCCTCCTCTCCTGTGGGG + Intronic
1079032975 11:16999328-16999350 CCAGGCCCTCCTCTGCCTGCAGG + Intronic
1080594584 11:33759421-33759443 CCAGGTCCCTCTCTCCTTTGTGG - Intronic
1081870324 11:46380250-46380272 CCAGCCCCTCCACTCCTGGGAGG - Exonic
1081998786 11:47380903-47380925 CCTGTCCCTCCCCTCCTTTTTGG - Intergenic
1083307685 11:61769636-61769658 CCGGGCCCACCTCACCTTAGAGG + Intronic
1083459797 11:62803462-62803484 CCAGCCCCTCCTCTCTCTGGAGG + Exonic
1084180429 11:67443233-67443255 CCAGCCTCTCCTCTCCTGGGCGG - Intronic
1084543531 11:69801809-69801831 GCAGGCCCTCCCCACCCTTGGGG - Intergenic
1084893989 11:72251923-72251945 GCCAGCCCTCCTCTCCTCTGGGG + Intergenic
1084954573 11:72684538-72684560 CCAGGGCCTCATCTTCTTAGTGG + Intergenic
1087716093 11:101610637-101610659 CCAGGCACTGATCTCCTCTGGGG - Intronic
1089288296 11:117421594-117421616 CTCCGCCCTCCTCTCCTCTGGGG - Intergenic
1090716222 11:129433672-129433694 CCAGGCTCTCCTCTGCGTGGGGG + Intronic
1092061115 12:5551319-5551341 CTAGTCCCTGCTCTCCATTGAGG - Intronic
1094539025 12:31347635-31347657 CCAGGACCTCATCTCCTCCGGGG - Intergenic
1094748937 12:33382365-33382387 CCAGGTCAGCCTCTCCATTGCGG - Exonic
1095135083 12:38590990-38591012 CCTGGGAGTCCTCTCCTTTGTGG + Intergenic
1095764781 12:45882232-45882254 CAAGGCCCAGGTCTCCTTTGTGG + Intronic
1096071260 12:48776646-48776668 CCAGGCCCTTCACTCCTCTCAGG + Intronic
1100343222 12:93701483-93701505 CCAGGCCATCTTGTCCCTTGTGG + Intronic
1102984578 12:117267873-117267895 GCATGCCCTCCTCTCCAGTGTGG - Intronic
1103004518 12:117409986-117410008 CCAGACCCTCCCCACCTTTCAGG - Intronic
1103257881 12:119558328-119558350 CCAGGCTCTCCTCTCTGTTCTGG + Intergenic
1104289638 12:127455818-127455840 CCAGCCCCGCCTCGCCTTTCCGG - Intergenic
1104945809 12:132414457-132414479 CCAGACCCTCCACTCCACTGTGG - Intergenic
1105957954 13:25301693-25301715 CCCGGCCCGCCTCGGCTTTGAGG + Exonic
1107556286 13:41519041-41519063 CCAGGCTCTCCTCTCCCACGAGG - Intergenic
1107787736 13:43971501-43971523 CCAGCCCCTCCACTCCTGGGAGG - Intergenic
1109324312 13:60849294-60849316 ACAGTCCCTCTTCTCCTTAGTGG + Intergenic
1112506057 13:99976184-99976206 CCATGTCCACCTCACCTTTGTGG + Intergenic
1113557865 13:111253036-111253058 CCAGGCCCCCTTCTCCTGTTGGG + Intronic
1113618202 13:111695777-111695799 GGAGGCCCTCTTCTCCTTTGGGG - Intergenic
1113623733 13:111781038-111781060 GGAGGCCCTCTTCTCCTTTGGGG - Intergenic
1113701357 13:112390997-112391019 CCAGACTCTCCTCCCTTTTGTGG - Intronic
1114418078 14:22557317-22557339 CCAGGCCCTCCTCTCCTTTGGGG - Intronic
1115120669 14:29932900-29932922 CAAGGGCCTCCTGTCCTTTCAGG - Intronic
1115360077 14:32490596-32490618 CCAGGGCCTCTCCTCCTTAGTGG + Intronic
1118818346 14:69328356-69328378 CAAGGCTCTCCTCTCCTTCAGGG - Intronic
1119137299 14:72232629-72232651 CCAGATCCGCCTCTCCATTGAGG - Intronic
1119323497 14:73745219-73745241 CCAGGCCCTCTACACCTATGTGG + Intronic
1119688772 14:76654327-76654349 CCACCACCTCCTCCCCTTTGGGG + Intergenic
1121082728 14:91121348-91121370 GAAGACCCTCCTCTCCTGTGGGG + Intronic
1121502382 14:94448504-94448526 CCTGGCCCTGCTCTCTCTTGGGG - Exonic
1121504898 14:94469585-94469607 CCTGGCCATGCTCTCCCTTGGGG - Exonic
1121846278 14:97175001-97175023 CCTGGCCCACCTCTCCTTCAGGG + Intergenic
1122079641 14:99257789-99257811 CCAGACCCTCGTCTTCTTCGAGG + Exonic
1122623273 14:103071591-103071613 CCAGCTCCTCCTCCCCTTTCAGG - Intergenic
1122879085 14:104681989-104682011 CCAGGCCCTCCTCCCCTCCCTGG - Intergenic
1122886419 14:104712411-104712433 CCCGGCCCTCCTCACCTTTCAGG + Exonic
1123016181 14:105376803-105376825 CCAGGTCCTCCTCTGCCTCGGGG - Exonic
1124256277 15:28145277-28145299 CCAGGCCCTCTGCTCCCTCGAGG - Intronic
1124567970 15:30833864-30833886 CCAGGCCCTCTGCTCCCTCGAGG + Intergenic
1124580873 15:30953938-30953960 CCTGGCCCTCCTGACCTGTGAGG + Intronic
1124661147 15:31551973-31551995 CCAGGCCCCCCTCAACATTGGGG - Intronic
1127973452 15:63979946-63979968 CCAGGAACTCCTCTCCTGGGAGG + Intronic
1129194685 15:73956761-73956783 CCAGGCTCTCCACCCATTTGTGG + Intergenic
1129206447 15:74039846-74039868 CCAGCCTCTCCCCTCCTCTGCGG - Intronic
1130064352 15:80592143-80592165 CCTGGCTCTGCTCTCCTCTGTGG + Intronic
1130180216 15:81619425-81619447 ACATGCCCTACTCTCCTCTGTGG - Intergenic
1132248714 15:100317447-100317469 GCAGACCCTCTGCTCCTTTGAGG - Intronic
1132801629 16:1757578-1757600 CCCAGCCCTCCTCTGCTTTCTGG + Intronic
1132949778 16:2554661-2554683 CCCGGGCCTCCTCTGCTCTGCGG + Intronic
1132964570 16:2645506-2645528 CCCGGGCCTCCTCTGCTCTGCGG - Intergenic
1133126884 16:3652904-3652926 CCAGGCCCTCCTCCCCCAGGGGG + Intronic
1133209960 16:4258025-4258047 CCCAGCCCTCCTCTCCCTTCTGG - Exonic
1133778837 16:8920714-8920736 CCAGCCCCTCCCCTGCTTAGAGG - Intronic
1134861973 16:17568381-17568403 CCAGGCCCTTCTCTTGCTTGGGG + Intergenic
1135052245 16:19202579-19202601 CCAGCCCCTCCCCTCCCTGGAGG + Intronic
1136383074 16:29905964-29905986 CCAGGACCTCCTCTCTACTGCGG + Exonic
1137463529 16:48687500-48687522 CCAGGGCCTCCTGTCCAGTGGGG + Intergenic
1139294871 16:65891862-65891884 CCTTCTCCTCCTCTCCTTTGAGG + Intergenic
1139631110 16:68232436-68232458 CGAGGCCCTCATCCGCTTTGTGG - Exonic
1139649964 16:68357297-68357319 GAAGGCCCTCCTCTCCTCTCTGG + Exonic
1139658846 16:68406391-68406413 CCTGGCCCTCCTCTTCCTTGGGG + Intronic
1140812372 16:78590812-78590834 CCAGGCACACCTCCCATTTGAGG - Intronic
1142377962 16:89716668-89716690 CCAAGCCCGCATCTCCTCTGTGG - Intronic
1142607528 17:1090381-1090403 CCACCCCCACCTCTCCTTAGAGG - Intronic
1142961468 17:3554722-3554744 CCAAACCCACCTCTTCTTTGTGG + Exonic
1143322215 17:6075663-6075685 CCAGGCCCTGCTCTTCTGTAGGG + Intronic
1143848833 17:9794237-9794259 CCAGCCCATCTTCTCCTCTGGGG + Intronic
1145016587 17:19402749-19402771 CCGGGCCGTCCCCTCCTTTCTGG - Intergenic
1145050619 17:19657287-19657309 CAAGGCCATCCTCCTCTTTGTGG - Intronic
1145251755 17:21300651-21300673 CCAGGCCCTGCTCACCTTCACGG - Exonic
1145271153 17:21405610-21405632 CCAGGCCCTGCCCTCCCCTGCGG + Intronic
1145309357 17:21692997-21693019 CCAGGCCCTGCCCTCCCCTGCGG + Intronic
1147138765 17:38450008-38450030 CCAGACCATCCTCTCCTGTGAGG + Intronic
1147248550 17:39138662-39138684 CCTGCCCCTCCTCTCCCCTGGGG - Intronic
1147536122 17:41324218-41324240 CCAGACCATCGGCTCCTTTGGGG - Intergenic
1147594565 17:41708535-41708557 TCAGACCCACCTCTCCTTTTTGG + Intergenic
1148243063 17:46012708-46012730 CCATCCACTCCTCTCCTTTCTGG + Intronic
1149215281 17:54347100-54347122 CCAGCCCCTCCTCCCTTTTGAGG - Intergenic
1149594426 17:57855822-57855844 CCAGGCCCAGCTTTCCTTTGAGG + Intergenic
1149645759 17:58240444-58240466 CCAGGCCCTCTTGCCCTGTGTGG + Intronic
1151876802 17:76871443-76871465 CCAAGCCCCTCTCTGCTTTGGGG + Intronic
1151882647 17:76904410-76904432 CCAGGCCCACCTGGACTTTGGGG - Exonic
1152204605 17:78967837-78967859 CCAGGGCCTCCTCTGCTGAGAGG + Intergenic
1152588277 17:81198767-81198789 CCAGCCCCTCCTCTGCTCTAGGG - Intronic
1152632854 17:81418307-81418329 CCAGGCCCAGCTCCCCTCTGTGG - Intronic
1152772774 17:82180294-82180316 CCAGGCCTGCCTCTCCTTGGAGG - Intronic
1153795472 18:8618077-8618099 CCAGCCACGCCTCTCCTTGGAGG + Intronic
1155164615 18:23222218-23222240 TCAGGCTCTCCTCACCTTTGGGG + Intronic
1155311867 18:24532170-24532192 CCAAGCTCTCCTCTCCTTGAGGG + Intergenic
1156478163 18:37419641-37419663 CCTGGCCTTCCTCTCCTGAGAGG + Intronic
1157166158 18:45360008-45360030 CCAGGCCCTGCACTCCTGTCAGG + Intronic
1157452632 18:47799870-47799892 TCTTGCCCTCCTCTACTTTGTGG - Intergenic
1157496169 18:48158949-48158971 CCAGCCCCTACCCTCCTCTGGGG - Intronic
1161030668 19:2056460-2056482 CCAGGCCCTCCTCTTCACTCTGG - Intergenic
1161168087 19:2799369-2799391 CCAGACCCTCCTATCCATTAAGG - Intronic
1161238591 19:3209752-3209774 ACAGGCCCTCCTCTCCTGCACGG - Intergenic
1161523323 19:4738208-4738230 CCCAGCTCTCCTCTCCTCTGGGG - Intergenic
1162112084 19:8404777-8404799 CCAGGGCCTCCCCTCCCCTGGGG + Intronic
1162723424 19:12675760-12675782 CCAGCCCCTCCCCTACTTTTTGG - Exonic
1162931484 19:13959922-13959944 CCAGGGCCTCCTGTACTCTGGGG + Intronic
1163839475 19:19597434-19597456 CCTGGTCCTCCTCTGATTTGTGG - Intronic
1164860137 19:31556153-31556175 CCAGTCTCTCCTCTCTTTGGAGG + Intergenic
1164979999 19:32606805-32606827 CCAGGCCCTGCTTTTCTTTAAGG - Intronic
1165096224 19:33411340-33411362 CCAGGCTGTCCTCTCCGTTCAGG - Intronic
1165743263 19:38216155-38216177 CGAGGACCTCATCTCCTGTGCGG - Exonic
1166793732 19:45413826-45413848 ACAGGCCCTCATCTCCCCTGGGG - Intronic
1167288965 19:48614355-48614377 CCAGGCCGTCCTCTGATCTGCGG + Intronic
1167322449 19:48805545-48805567 CCAGGCTCTACTCCCGTTTGGGG + Intronic
925210508 2:2041710-2041732 CCAGGCCCTTCCCTTCTTTCCGG - Intronic
926859235 2:17291561-17291583 CCAGGGCCTCCTCTCTGCTGAGG - Intergenic
928258951 2:29749650-29749672 CCATGACCTCCTTTGCTTTGGGG - Intronic
928769924 2:34694497-34694519 CCAGGCCCTCCTTGGCTCTGTGG + Intergenic
929856245 2:45640695-45640717 CCAGGCTCTCCTCTTCTTCCTGG + Intergenic
931284662 2:60821724-60821746 CCAGGCCTTCTCTTCCTTTGGGG + Intergenic
931756891 2:65382469-65382491 CCAGAGGCTCCTCTCCTTAGTGG - Intronic
932486379 2:72086666-72086688 GCAGGCACTCCTCTCCTTTTTGG - Intergenic
933704526 2:85279827-85279849 CCAGGACCACCTCTCCCTTCTGG + Intronic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
935242565 2:101191062-101191084 GCATGCCCTCCTCTCTTTTATGG - Intronic
936063512 2:109313476-109313498 CCAGGCCCTGCCCTCCTTGCTGG + Intronic
938381410 2:130838262-130838284 CCATGCCCTCCACACCTTTCAGG + Intronic
939629064 2:144513209-144513231 CCAGCACCTCCACTCCTTTAAGG + Intronic
940063852 2:149604303-149604325 CCAGGCCCTCCTTAACTTTAAGG - Intergenic
940845741 2:158640226-158640248 CCAGCCCTTCCTCTCCCTTCAGG + Intronic
944049743 2:195454311-195454333 CCAAGCCCTCCTTGCCCTTGAGG + Intergenic
946229349 2:218282068-218282090 CCAGGCCCTCCGCCCCCTGGGGG - Exonic
947288355 2:228543532-228543554 CCTTGGCCTCCTCTCCTTTAAGG - Intergenic
948460792 2:238129008-238129030 CCAGGGGCCCCTCTCCTCTGTGG + Intronic
948590868 2:239049256-239049278 CCCCGCCCTCCTCTCCTTCAAGG + Exonic
949014610 2:241702261-241702283 CCGCGCCCTCCCCTCCCTTGCGG - Intronic
1168814765 20:728826-728848 CCGGGCCCTCATCCCCTGTGCGG - Intergenic
1170036542 20:11995871-11995893 CCAGGAGCACCTCTCCTCTGGGG - Intergenic
1170373421 20:15674300-15674322 CCAGGGCCCCCTCTCCAGTGAGG - Intronic
1171348897 20:24487797-24487819 CCAGGACCTCCTCTTCTTGACGG - Intronic
1172332404 20:34084413-34084435 CCAAGCCTTGCTCTCCTTTTGGG - Intronic
1172460679 20:35116020-35116042 ACAGGCCCTCAGCTGCTTTGTGG - Intronic
1172656312 20:36540927-36540949 CCAGGTCCCCTTCTCCTTTGAGG + Intergenic
1172958413 20:38778914-38778936 GCAAGTCATCCTCTCCTTTGGGG - Intergenic
1174553676 20:51379059-51379081 CCAGGCGCCCATCTGCTTTGTGG + Intergenic
1175295014 20:57902439-57902461 CCAGCCCCTCTGCTCATTTGTGG - Intergenic
1175865547 20:62174284-62174306 CCAGCCCCTCCAGTCCTGTGAGG - Intronic
1179008628 21:37535799-37535821 CCAAGTCCTCCTCTCCTCCGTGG - Intergenic
1179829418 21:43987208-43987230 CCAGGCACTCCTGTCCCATGGGG + Intergenic
1179878524 21:44283779-44283801 CTTGGCTTTCCTCTCCTTTGAGG - Intergenic
1179998172 21:44983576-44983598 CCAGGGCCTTCTGTCCTATGTGG - Intergenic
1180226063 21:46393186-46393208 CCAGGCCCTCCTGGCCCTGGAGG - Intronic
1181116383 22:20634729-20634751 CCTGCCCCTGCTCTGCTTTGTGG - Intergenic
1181429314 22:22868313-22868335 CCAGGGCCTCTTCTCCTCGGTGG + Intronic
1182145258 22:27993398-27993420 GCAGGCCCTCCTCACCGCTGTGG - Exonic
1182263591 22:29094379-29094401 CCAGGCCCCCCTCCCCGTTGGGG - Exonic
1182359531 22:29738425-29738447 CCTGGCTCGCCTCTCCTCTGTGG + Exonic
1183338781 22:37266728-37266750 CCTGGCCCATTTCTCCTTTGAGG + Intergenic
1183410782 22:37653937-37653959 CCAGGTCCTCCTATCTTTTTAGG + Intronic
1183785029 22:40024295-40024317 CCAGGAGCTCCTCTCCTAAGAGG + Intronic
1184200704 22:42967279-42967301 CTGGTCCCTGCTCTCCTTTGAGG - Intronic
1184240858 22:43210624-43210646 CCAGGCCCTGCTCTAGTTTCTGG - Intronic
1184373375 22:44096911-44096933 CCAGGCCCACCTAGCCTGTGTGG + Intronic
1184393796 22:44220814-44220836 CCACGGCCCCCTCTCCTTGGTGG - Intergenic
1184468679 22:44683563-44683585 CCAGCCCCTGCCCTCCTTCGGGG - Intronic
1184471488 22:44698586-44698608 CCGGGCCCTCCTCTCACTTATGG - Intronic
1185220410 22:49626661-49626683 CAAGCCCCTCCCCTCCTTAGAGG - Intronic
949555318 3:5147562-5147584 TCATTCCCTTCTCTCCTTTGAGG + Intronic
950078578 3:10205289-10205311 CCCAGCCCTCCCCTCCTCTGGGG - Intronic
950337961 3:12214399-12214421 TCAGCCCCTCCTCTACTGTGGGG - Intergenic
951277747 3:20710528-20710550 CCACTCTTTCCTCTCCTTTGGGG - Intergenic
951303370 3:21026415-21026437 CCAGGTGCCCTTCTCCTTTGGGG + Intergenic
953412676 3:42699017-42699039 CCAGGTCCAGCTCACCTTTGGGG + Exonic
954301727 3:49703970-49703992 GCAGGCCCTTATCTCCTGTGTGG - Intronic
954514762 3:51163589-51163611 CCTGGCACTCCTCTCCTTTTGGG - Intronic
955466482 3:59242747-59242769 CCAGGCCCCCCACCCTTTTGTGG - Intergenic
956237837 3:67094703-67094725 CCAAGGCCTCCTCTCCCTAGGGG + Intergenic
959013347 3:101104574-101104596 CCAAGCCCCCCTCTGCTTTTAGG - Intergenic
959906636 3:111717644-111717666 CCAGAGCCTCCTCACCTTGGAGG - Intronic
961198922 3:125028374-125028396 CCTGTTCCTCCTCTCCTTTGTGG + Intronic
961318578 3:126057052-126057074 CCAGGCCCTCCTCTGCCAGGAGG - Intronic
967108414 3:186272133-186272155 CCAGTCCCTTCTCTGCCTTGAGG - Intronic
967969379 3:194987880-194987902 CAGGGCCGTCCTCTCCTCTGAGG + Intergenic
968473497 4:792304-792326 CCTGGGCCTCCTACCCTTTGGGG - Intronic
968751161 4:2389755-2389777 GCAGGGCCACCTCTCCTTAGGGG - Intronic
971195583 4:24470231-24470253 CCAAGCCCTGCTCGTCTTTGAGG - Intergenic
971367319 4:25987799-25987821 CCAGCCTCTCCTCTCCTATATGG + Intergenic
973632348 4:52831368-52831390 CAAGGCCCTCCTTGCCTGTGAGG - Intergenic
973680938 4:53319157-53319179 CCATTCCATCCTGTCCTTTGTGG - Intronic
974572407 4:63670030-63670052 CCAGGCATTCCTCTCCAGTGAGG + Intergenic
975790685 4:77946672-77946694 CCAGTCCCTCCCCTCCATTCAGG + Intronic
981762571 4:148210050-148210072 CCATTCCCTCCTCTCCTGGGAGG + Intronic
982444107 4:155470218-155470240 CCATGTCCACCTCTTCTTTGTGG + Intergenic
985907994 5:2856329-2856351 CCAAGGCCTCCCCTCCTCTGTGG + Intergenic
987325961 5:16811962-16811984 CCTGCTCCTCCTCTCCTTAGCGG + Intronic
989598245 5:43177978-43178000 CCAGCCCCTCTTCTCCCTGGAGG + Intronic
990149416 5:52800024-52800046 GCGGCCCCGCCTCTCCTTTGGGG + Exonic
996402879 5:123082628-123082650 CCAGGACCTCATCTCCCTGGGGG - Intergenic
997294168 5:132759625-132759647 CCAGGCCCTTCCTTCCTTGGTGG - Intronic
998394299 5:141808595-141808617 CTAGGCCCTCCTCTCATCTGGGG - Intergenic
998778360 5:145628692-145628714 CCAGCTCCTCCTCTTCTTTCAGG + Intronic
999947642 5:156614457-156614479 CCAGGTATTCCTCTCCTTTTTGG + Intronic
1002196587 5:177504642-177504664 CCAGGGCGTGTTCTCCTTTGAGG - Exonic
1002536417 5:179878610-179878632 CAAGTCCCACCTCTCCTCTGTGG - Intronic
1003328384 6:5109809-5109831 CCAGTACCTCCTCTCCTAAGAGG + Intronic
1004472423 6:15941217-15941239 CCAGACCTGCCTCTCATTTGTGG - Intergenic
1006167134 6:32071546-32071568 CCTGGTCCTCATCTGCTTTGCGG + Intronic
1006808986 6:36807789-36807811 CCAGGCCCTACTCTCCCTACGGG + Intronic
1008323537 6:50148136-50148158 ACCTGCCATCCTCTCCTTTGTGG - Intergenic
1008759595 6:54837830-54837852 CCAGGCCATCTTCTTCCTTGGGG - Intergenic
1009279941 6:61736317-61736339 CCAAGGTCTCATCTCCTTTGTGG + Intronic
1009436973 6:63630153-63630175 CCAGCACCTCCTCTAGTTTGAGG + Intergenic
1011747415 6:90419649-90419671 GCAGGCCCTCCTCCCCATTTTGG + Intergenic
1013587238 6:111590606-111590628 CCAGGCTCTTCTCTCTCTTGGGG - Intronic
1014885306 6:126773373-126773395 CCAGGGCCGCCCCTCCTCTGAGG - Intergenic
1015117864 6:129669109-129669131 CCAGGCACTACTCTCCTCTGTGG + Intronic
1016371587 6:143380173-143380195 TCAGGCTCTCCTCTCCTTAAAGG - Intergenic
1017615610 6:156243728-156243750 GCTGGCTCTCCTGTCCTTTGTGG + Intergenic
1017838722 6:158204307-158204329 CCTGGCCCTCCCCTCCTTTAAGG - Intergenic
1018127103 6:160692238-160692260 CCAGGCAGTTCTCTCCCTTGGGG + Intergenic
1018149457 6:160924841-160924863 CCAGGCAGTTCTCTCCCTTGGGG - Intergenic
1018940786 6:168307974-168307996 CCAAGCCCTGTTCCCCTTTGAGG - Exonic
1019201630 6:170321076-170321098 CCAGGCACTCCCTTCCTGTGAGG - Intronic
1019626149 7:2016584-2016606 CCTCGCCCTCCTCGCCTGTGGGG - Intronic
1019633709 7:2064314-2064336 CCAGGGCCTCCTCTCTTCTTGGG - Intronic
1021001516 7:15337410-15337432 CCAGACCCTCCTCTGTTTTATGG - Intronic
1023504351 7:40884716-40884738 CCAGTCTCTCTCCTCCTTTGGGG - Intergenic
1023718726 7:43071664-43071686 CCAGCTCCTCCTCTTCTGTGTGG - Intergenic
1023849808 7:44144432-44144454 GCTGGCCCTTCTCCCCTTTGTGG + Exonic
1026326516 7:69315236-69315258 CCAGCCCCTCCAGTCCTTTTGGG + Intergenic
1026435751 7:70396177-70396199 ACAGGTCCCCATCTCCTTTGTGG + Intronic
1027202244 7:76071638-76071660 CCAGGCCCAGCTCTCCTTGCCGG - Intergenic
1029288050 7:99479657-99479679 CCAGGAGCTGCTCTCGTTTGAGG + Exonic
1030560818 7:111083508-111083530 CCTCGTTCTCCTCTCCTTTGCGG - Intronic
1030583740 7:111391248-111391270 CAAGGCTCTCCACTCCCTTGTGG + Intronic
1035094335 7:156341242-156341264 CCAGGCCAACCCCTCCTTTCTGG + Intergenic
1035195775 7:157219176-157219198 CCAGACCCTCCTCTCCTGGGAGG - Intronic
1035892201 8:3357239-3357261 CAAGGCCCTCCTGTCCAGTGCGG + Intronic
1035926368 8:3732092-3732114 CAAGGCCCTCCTTTCCCTGGTGG - Intronic
1036487761 8:9195099-9195121 ACAGGCCCGCCTCTGCTGTGGGG + Intergenic
1036648310 8:10625733-10625755 CCAGGCCCTCTGCTCCTGCGTGG - Intronic
1037926468 8:22847469-22847491 CCAGGATCTCCTGTCCCTTGGGG - Intronic
1037960377 8:23093032-23093054 GCAGCCCCACCTCTCCTCTGGGG - Intronic
1038324942 8:26566007-26566029 CCAGGCTCTCCTCTTCTTCTAGG - Intronic
1038462852 8:27730990-27731012 CCAGGACCTCCTGGGCTTTGGGG + Intergenic
1038515336 8:28183186-28183208 CCAGGACATCCACCCCTTTGGGG - Intronic
1039466931 8:37791188-37791210 CCAGGCCCTCTTCTCTTCTGTGG - Intronic
1039890286 8:41681387-41681409 CTGGGCCGTCCTCTCCTATGTGG + Intronic
1042382891 8:68139273-68139295 TCAGGGCCTGCTCTCCTTTTAGG - Intronic
1042686502 8:71447182-71447204 CCAGACCTTCCTCCTCTTTGGGG + Intronic
1044945143 8:97382364-97382386 CCAGACTCTCCTCTCCCTAGAGG - Intergenic
1046892318 8:119436227-119436249 CCAGCCCCTCCTGTCCAGTGGGG + Intergenic
1047822024 8:128531371-128531393 CAGGGCCTTCCTCTGCTTTGGGG - Intergenic
1049850368 8:144827293-144827315 CTGGGCCCTCCTCTCCCTCGCGG + Intergenic
1051901813 9:22051128-22051150 GCAGGCCTTCCTCTGGTTTGTGG + Intergenic
1056234125 9:84574724-84574746 CCAGGCCCTGCTCTCTTTAAGGG + Intergenic
1056833270 9:89933509-89933531 GCAGGCACTTCTCTCCTCTGTGG - Intergenic
1057858033 9:98617284-98617306 CCAGATCCTCACCTCCTTTGGGG - Intronic
1059941144 9:119361083-119361105 CCAGGCTCTCCATTCCTGTGTGG + Intronic
1060051915 9:120383892-120383914 CCAGGCCCAGGGCTCCTTTGTGG - Intergenic
1060399848 9:123342074-123342096 CCAGGACCCCATCTCCTTGGAGG + Intergenic
1061287316 9:129631443-129631465 CCAGGCCCACCTCACCCTTCAGG - Intronic
1062154643 9:135039944-135039966 CCAGCCCCTACTCTCCGATGAGG + Intergenic
1062197750 9:135283789-135283811 TCAGCCCCTCCTCTGCTGTGGGG + Intergenic
1062319572 9:135984190-135984212 CCAGCCCCTCCTGCCCTTTAGGG - Intergenic
1062380762 9:136285517-136285539 CCAGGCCCTCAGCCCCTCTGCGG - Exonic
1062715657 9:138008900-138008922 CCAGGCCCTGCTGGCATTTGGGG - Intronic
1186643748 X:11484265-11484287 CCCTGCCCTCCTCTCTTTTTTGG - Intronic
1190191239 X:48278898-48278920 CCTACCCCTCCTCTCCTCTGCGG - Intergenic
1190630460 X:52380879-52380901 CCAGGCCCTCCTCCCCTCTATGG - Intergenic
1193083617 X:77428646-77428668 TCAGGCCTCCTTCTCCTTTGGGG - Intergenic
1196741831 X:119032006-119032028 CCAGGCCCTGCTCCCCTGTCAGG - Intergenic
1197721889 X:129750845-129750867 CCTGGTCCTCCTCCCCTTAGTGG - Intronic
1198102910 X:133437397-133437419 CCAGACCCTGCTCTCGTATGTGG + Intergenic
1199686773 X:150272122-150272144 CCAGGCCATCCCCTCATTTCTGG - Intergenic
1199986872 X:152959139-152959161 CCTGGCCCTTCCCCCCTTTGTGG + Intronic
1199996691 X:153030559-153030581 CCAGGGCCTCCTCTCCTCTCAGG + Intergenic
1200045074 X:153396871-153396893 CCGGGGCCTCCTCTCCTCTCAGG - Intergenic
1200418348 Y:2935815-2935837 CCCGTCCCTCCTCCCCTTCGCGG - Intronic
1200879982 Y:8202553-8202575 CCAGGCCCTGCTCCCATATGGGG - Intergenic