ID: 1114418719

View in Genome Browser
Species Human (GRCh38)
Location 14:22561832-22561854
Sequence ATTTCCTGGCCCCTATCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114418719_1114418727 4 Left 1114418719 14:22561832-22561854 CCATGTGATAGGGGCCAGGAAAT No data
Right 1114418727 14:22561859-22561881 GGGCAGGAGGTGCTCAGGGCTGG No data
1114418719_1114418726 0 Left 1114418719 14:22561832-22561854 CCATGTGATAGGGGCCAGGAAAT No data
Right 1114418726 14:22561855-22561877 GTGTGGGCAGGAGGTGCTCAGGG No data
1114418719_1114418729 28 Left 1114418719 14:22561832-22561854 CCATGTGATAGGGGCCAGGAAAT No data
Right 1114418729 14:22561883-22561905 CTTCCCACCACTGCAAAGAATGG No data
1114418719_1114418725 -1 Left 1114418719 14:22561832-22561854 CCATGTGATAGGGGCCAGGAAAT No data
Right 1114418725 14:22561854-22561876 TGTGTGGGCAGGAGGTGCTCAGG No data
1114418719_1114418728 5 Left 1114418719 14:22561832-22561854 CCATGTGATAGGGGCCAGGAAAT No data
Right 1114418728 14:22561860-22561882 GGCAGGAGGTGCTCAGGGCTGGG No data
1114418719_1114418724 -9 Left 1114418719 14:22561832-22561854 CCATGTGATAGGGGCCAGGAAAT No data
Right 1114418724 14:22561846-22561868 CCAGGAAATGTGTGGGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114418719 Original CRISPR ATTTCCTGGCCCCTATCACA TGG (reversed) Intergenic