ID: 1114418726

View in Genome Browser
Species Human (GRCh38)
Location 14:22561855-22561877
Sequence GTGTGGGCAGGAGGTGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114418719_1114418726 0 Left 1114418719 14:22561832-22561854 CCATGTGATAGGGGCCAGGAAAT No data
Right 1114418726 14:22561855-22561877 GTGTGGGCAGGAGGTGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114418726 Original CRISPR GTGTGGGCAGGAGGTGCTCA GGG Intergenic