ID: 1114423008

View in Genome Browser
Species Human (GRCh38)
Location 14:22600311-22600333
Sequence CTTGAAAAGCTGAGGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1179
Summary {0: 1, 1: 1, 2: 10, 3: 135, 4: 1032}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114423008 Original CRISPR CTTGAAAAGCTGAGGCTGGA AGG Intronic
900849340 1:5130275-5130297 CTTGAAGAGTTGATGCTAGAAGG + Intergenic
900907523 1:5571372-5571394 TTAGACAAGTTGAGGCTGGATGG + Intergenic
901505291 1:9681343-9681365 CTTGAGAGGGTGAGGCTGGAGGG - Intronic
902928036 1:19710212-19710234 CTTGGGACGCTGAGGCAGGAGGG - Intronic
903077418 1:20782473-20782495 CTTGGGAAGCTGAGACTGGGAGG + Intronic
903105958 1:21080205-21080227 CTTGGAAAGCTAAGGGAGGAGGG + Intronic
903988155 1:27244447-27244469 CTAGGAAGGCTGAGGCAGGAGGG - Intronic
904021179 1:27467104-27467126 CTTGGGAAGCTGAGGTGGGAGGG + Intronic
904096410 1:27981668-27981690 CTCGAAAAGCTGAGGTGGGAGGG + Intronic
904568411 1:31442416-31442438 CTTGAAAGGCTGAGGTGGGAGGG + Intergenic
904587309 1:31587424-31587446 CTTGAGAGGCTGAGGTGGGAGGG - Exonic
904730635 1:32588389-32588411 CTTGAAACTATGAGCCTGGATGG + Intronic
905149776 1:35918661-35918683 CTTGGGAGGCTGAGGCGGGAAGG - Intronic
905260304 1:36712732-36712754 GATGAAAAGCTTAGGGTGGAAGG + Intergenic
905344614 1:37302752-37302774 CTGGCAAAGCTGAGTCTGGGAGG - Intergenic
905405517 1:37729795-37729817 CCTGGAAAGTTGAGGCTGCAGGG + Intronic
905435766 1:37954154-37954176 TTTGCACAGTTGAGGCTGGAGGG + Intergenic
905436288 1:37957572-37957594 CTTGGGAGGCTGAGGCAGGAGGG - Exonic
905655113 1:39682053-39682075 CTCCAAAGGCTGGGGCTGGAAGG + Exonic
905699079 1:39998505-39998527 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
906144547 1:43552138-43552160 CTGGAAAGGATGAGGCGGGAAGG - Intronic
906394126 1:45445685-45445707 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
906632614 1:47385153-47385175 CTCGGAAAGCTGAGGTGGGAGGG - Intergenic
906972648 1:50533177-50533199 CTTGGAGAGCTGAGGCTACAGGG - Intronic
907222084 1:52914506-52914528 CAGGATAAGCTGAGGCAGGAGGG + Intronic
907223582 1:52924999-52925021 CTTGAGGAGCTGAGGCAGAAAGG - Intronic
907346613 1:53786936-53786958 TTTGGGAGGCTGAGGCTGGAGGG - Intronic
908376800 1:63551164-63551186 CATCAAAAGCTGAGGTTGCAGGG - Intronic
908544581 1:65149888-65149910 CTTGAAATGCTGCGGTTTGAGGG + Intronic
908587015 1:65580892-65580914 CTTGAAAAGTTGAGTGTGGTGGG + Intronic
908598478 1:65712757-65712779 CTTGGTAGGCTGAGGCAGGAAGG + Intergenic
908725832 1:67175931-67175953 CTTGGGAGGCTGAGGCTGGAAGG - Intronic
908876012 1:68676670-68676692 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
909290054 1:73871091-73871113 TTTGGGAAGCTGAGGCAGGAAGG - Intergenic
909458717 1:75882729-75882751 CTTGAAAGGCTGAGGCAGGCAGG + Intronic
909605214 1:77501055-77501077 CTAGAAAAGCTGAGAATCGAGGG + Intronic
909636662 1:77824316-77824338 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
909714438 1:78690975-78690997 CCTGAAACACTGATGCTGGAAGG + Intergenic
909838267 1:80285432-80285454 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
910484667 1:87700169-87700191 CTTCAGAAGCTGAGGCAAGAGGG + Intergenic
910792941 1:91069876-91069898 CTTGAAAGGCTGAAGGTGGGAGG - Intergenic
910882955 1:91938947-91938969 CTTGGAAGGCTGAGGTTGGAGGG + Intergenic
910970140 1:92847977-92847999 CTTGAGAGGCTGAGGCAGGTGGG - Intronic
911269491 1:95782911-95782933 GTTAAAAAGCTGAGGCTTTATGG + Intergenic
911371946 1:97004370-97004392 CATGAATAGCTGGGGCTGGGAGG + Intergenic
911702134 1:100966118-100966140 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
912236494 1:107856929-107856951 CTTGGCAGGCTGAGGCAGGAGGG + Intronic
912262244 1:108121764-108121786 CTCGGAAGGCTGAGGCAGGAGGG - Intergenic
912756013 1:112325405-112325427 CTGGTAAAACTGTGGCTGGAAGG - Intergenic
913105382 1:115609544-115609566 CTTGAGAGGCTGAGGCAGGAAGG - Intergenic
913968655 1:143397257-143397279 GTTGAAAAGCAGTGTCTGGACGG - Intergenic
914063034 1:144222856-144222878 GTTGAAAAGCAGTGTCTGGACGG - Intergenic
914116116 1:144743498-144743520 GTTGAAAAGCAGTGTCTGGACGG + Intergenic
914519922 1:148406053-148406075 CTTGGGAAGCTGAGGCTGGCAGG + Intergenic
914819844 1:151092494-151092516 TTTGGAAGGCTGAGGATGGAAGG - Intronic
914870335 1:151468345-151468367 CTGGAGAGGCTGAGGCGGGAAGG + Intergenic
915199519 1:154216620-154216642 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
915305828 1:154977486-154977508 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
915320563 1:155053835-155053857 ATTGACAAGCAGAGGCTTGAAGG - Intronic
915527596 1:156485625-156485647 CTTGGGAGGCTGAGGCTGGAAGG - Intronic
916139790 1:161685566-161685588 CTTGGAAGGCTGAGGTCGGAGGG + Intergenic
916185578 1:162129338-162129360 GTTTAAAAAATGAGGCTGGATGG - Intronic
916227811 1:162507513-162507535 TTTGGGAAACTGAGGCTGGAAGG - Intronic
917283683 1:173403092-173403114 TTTGGGAGGCTGAGGCTGGAGGG - Intergenic
917896458 1:179493168-179493190 GGTGACAAGATGAGGCTGGAAGG - Intronic
918352887 1:183675901-183675923 TTTGAGAGGCTGAGGCAGGAGGG + Intronic
919554712 1:199036237-199036259 AGAGAAAAGCTGAGGCTAGAAGG - Intergenic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
919881504 1:201904094-201904116 CGTGAAAAGAGGAGGCTGGTGGG - Intronic
920105993 1:203554010-203554032 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
920241108 1:204551286-204551308 TTTGAGAGGCTGAGGCAGGAGGG - Exonic
920379467 1:205527369-205527391 CTTGAGAGGCTGAGGCAGGAGGG + Intronic
920420886 1:205832568-205832590 CTTCATCAGCTGTGGCTGGAGGG - Intronic
922114160 1:222593916-222593938 CTTGAGAAGCGGAGGTTGCAGGG + Intergenic
922281064 1:224124833-224124855 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
922810317 1:228411732-228411754 CTTGGAAGGCTGAGGTGGGAGGG - Intronic
923036467 1:230288159-230288181 CCTGAGAAGCTGAGGCTGATGGG + Intergenic
923134332 1:231104818-231104840 TTTGGGAGGCTGAGGCTGGAGGG + Intergenic
923152925 1:231250321-231250343 CTCGAGAGGCTGAGGCAGGAGGG + Intronic
923231829 1:231993972-231993994 CTTTAAAATCTGAGGCTGGTTGG + Intronic
923519020 1:234721734-234721756 TCTGAGAAGCTGAGGCTGGGTGG + Intergenic
923669587 1:236029067-236029089 CTTGGGAAGCTGAGGCAGGAGGG + Intronic
924045824 1:240029543-240029565 CTTGGAAGGCTGAGGTAGGAGGG - Intronic
924255724 1:242180873-242180895 CTTGGGAAGCTGAGGCAGGAGGG + Intronic
924550307 1:245069935-245069957 CTTGGGAAGCTGAGACAGGAGGG + Intronic
924712276 1:246539509-246539531 CTTGGAAGGTTGAGGCAGGAGGG - Intergenic
924765858 1:247031807-247031829 CTTGGGAGGCTGAGGCTGGCGGG - Intergenic
1062827177 10:581074-581096 CTAGAAAAGCTGACCCTGAAGGG - Intronic
1062968422 10:1627877-1627899 CTTGAAGAGGTGGAGCTGGAGGG + Intronic
1064206053 10:13324717-13324739 CTTGGGAAGCTGAGGTTGGGAGG - Intronic
1064219651 10:13429763-13429785 TTTGGGAAGCTGAGGCAGGAGGG + Intergenic
1064577510 10:16761183-16761205 TTTGAGAGGCTGAGGCTGGCAGG - Intronic
1064689219 10:17896686-17896708 TTTGAGAGGCTGAGGCAGGAGGG + Intronic
1064701709 10:18028825-18028847 CTCGGGAGGCTGAGGCTGGAGGG - Intronic
1064974196 10:21096619-21096641 CTGGGAAAACTGAGGCAGGAGGG - Intronic
1065042497 10:21711636-21711658 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1065126784 10:22581486-22581508 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1065217535 10:23463789-23463811 CTTGAGAGGCTGAGGCAGGAGGG + Intergenic
1065353479 10:24816465-24816487 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1065445253 10:25791711-25791733 CTTGGAAAGCTGAGGTGGGAGGG + Intergenic
1065520869 10:26570580-26570602 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
1065676735 10:28183544-28183566 TTTGGGAAGCTGAGGCAGGAGGG + Intronic
1065737213 10:28765045-28765067 CTTGGGAGGCTGAGGCTGGAGGG + Intergenic
1065821365 10:29528628-29528650 CTTGGGAGGCTGAGGTTGGAGGG + Intronic
1065949440 10:30638611-30638633 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1066095147 10:32065212-32065234 TTTGAGAAGCTGAGGCTGGTGGG - Intergenic
1066275759 10:33866682-33866704 CTTGGGAGGCTGAGGCTGGAGGG + Intergenic
1066359342 10:34715183-34715205 CTTGGAAGGCTGAGGCAGGTGGG - Intronic
1066631197 10:37460805-37460827 CTTGAAAGGCTGAGGTGGGAAGG + Intergenic
1066641556 10:37559195-37559217 ATCAAAAAGCTGAGGCTGTATGG - Intergenic
1066668141 10:37807142-37807164 CTTAAAAAAATGATGCTGGAGGG - Intronic
1067012554 10:42727993-42728015 TTTGGGAGGCTGAGGCTGGAGGG + Intergenic
1067142405 10:43668368-43668390 CCTGAAAGGCTGAGGAGGGAGGG - Intergenic
1067147612 10:43704503-43704525 CTTGAAGAGCTAAAGCTGGAAGG - Intergenic
1067311037 10:45113895-45113917 TTTGGGAGGCTGAGGCTGGAGGG - Intergenic
1068547001 10:58358866-58358888 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1068769637 10:60806644-60806666 CTTAGGAAGCTGAGGCAGGAAGG - Intergenic
1068912180 10:62389989-62390011 CTTGACTAGCTGTGGCTGGAGGG + Intronic
1069034974 10:63636987-63637009 AGTGAAAAGCTGAGCCTAGAAGG - Intergenic
1069366435 10:67699086-67699108 CTTGAAAAGGTGAGGGAAGAAGG - Intergenic
1069626384 10:69870418-69870440 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1069858766 10:71457138-71457160 TTTGATAGGCTGAAGCTGGAGGG + Intronic
1069968505 10:72143443-72143465 CTTGAGAGGCTGAGACTGGAGGG - Intronic
1070113572 10:73507881-73507903 CTCGGAAGGCTGAGGCAGGAGGG + Intronic
1070296685 10:75167698-75167720 CTTGAGAGGCTGAGGTGGGAGGG - Intronic
1070648936 10:78221190-78221212 TTGGGAAAGCTGAGGCTGGAAGG + Intergenic
1070743960 10:78921388-78921410 TTTGGGAAGCTGAGGCTGGTGGG - Intergenic
1070899055 10:80011766-80011788 CTTGGGAAGCTGAGGTGGGAGGG + Intergenic
1071237427 10:83665415-83665437 CTTGGGAGGCTGAGGCAGGAAGG + Intergenic
1071671548 10:87613622-87613644 GTTGGGAAGCTGAGGCTGGAGGG + Intergenic
1071706976 10:88009735-88009757 CTTGGGAAGCTGAGGCAGAAGGG - Intergenic
1072107586 10:92289431-92289453 CTTGGGAAGCTGAGGCTAGAAGG + Intronic
1072597225 10:96885487-96885509 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1072838236 10:98740281-98740303 CTTGGGAGACTGAGGCTGGAGGG - Intronic
1073104474 10:101024349-101024371 CTTGGAAGGCTGAGGCAGGAGGG - Intronic
1074164421 10:110862410-110862432 CTTAAAAAGCAGAGGCCGCAGGG - Intergenic
1074196594 10:111192525-111192547 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1074284615 10:112086397-112086419 CTGGAGAAGCTGAGGCAAGAAGG + Intergenic
1074748346 10:116558300-116558322 CTTGGGAGGCTGAGGCAGGATGG - Intronic
1074835087 10:117284007-117284029 CTGAAAAACCTTAGGCTGGAAGG - Exonic
1074969993 10:118528286-118528308 CTTGGGAAGCTGAGGCAGGAGGG - Intergenic
1075278053 10:121113027-121113049 GCAGCAAAGCTGAGGCTGGAGGG + Intergenic
1075403406 10:122177459-122177481 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1075729530 10:124628034-124628056 CTTGTTGGGCTGAGGCTGGACGG - Intronic
1076143216 10:128096174-128096196 CTTGAGAGGCTGAGGAGGGAGGG - Intergenic
1078157565 11:8811839-8811861 CTTCAGAGGCTGAGGCAGGAGGG - Intronic
1078200872 11:9181628-9181650 CTTGAGAGGCTGAGGTAGGAGGG + Intronic
1078313062 11:10265795-10265817 CTTGAGAGGCTGAGGCAGGAGGG - Intronic
1078497010 11:11827619-11827641 CTTGAGAGGCTGAGGTTGGAGGG - Intergenic
1078648243 11:13162772-13162794 CTTATAATGCAGAGGCTGGAAGG - Intergenic
1079043790 11:17082049-17082071 TTTGGAAGGCTGAGGCTGGAGGG - Intronic
1079079032 11:17401254-17401276 CTTGAGAAGAGGAGGCTGGGAGG + Intronic
1079164032 11:18020904-18020926 CTTGAACACCTGATCCTGGAGGG - Exonic
1079322544 11:19463663-19463685 CAGAAAAAGCTGAGTCTGGAAGG + Intronic
1079398322 11:20085084-20085106 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1079497887 11:21066844-21066866 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1079959566 11:26906446-26906468 CTCGAGAGGCTGAGGCTGGAGGG - Intergenic
1080010052 11:27449472-27449494 CTCAAAAGGCTGAGGCAGGAGGG + Intronic
1080080615 11:28214148-28214170 CTTGAGAGGCTGAGGCAGAAGGG - Intronic
1080615629 11:33942524-33942546 CTTGGAAGACTGAGGCAGGAAGG + Intergenic
1081551333 11:44115295-44115317 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1081724809 11:45320869-45320891 CTGGAGAAGCTGAGGCAGCATGG + Intergenic
1081740660 11:45437525-45437547 TTTGAAGAGCTGTGGCTGCAGGG + Intergenic
1081935140 11:46899018-46899040 CTGGCACTGCTGAGGCTGGAGGG + Exonic
1082039793 11:47675494-47675516 CTTGGGAGGCTGAGGCGGGAGGG - Intronic
1082046066 11:47728642-47728664 CTTGGAAGGCTGAGGTGGGAAGG - Intronic
1082804872 11:57441516-57441538 CTGGGAAGGCTGAGGCAGGAGGG + Intergenic
1082837590 11:57663003-57663025 CTGTACAAGATGAGGCTGGAGGG + Intergenic
1082858520 11:57831109-57831131 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1082917719 11:58455953-58455975 CTAGGAAGGCTGAGGCAGGAGGG + Intergenic
1082953612 11:58845356-58845378 CTTGGGAAGCTCAGGCAGGAGGG + Intronic
1083254129 11:61485955-61485977 CTAGAAACCCTGAGACTGGAGGG - Intronic
1083308845 11:61774409-61774431 CTTGGGAAGCTGAGGCAGGCAGG + Intronic
1083469539 11:62873909-62873931 CTTGGGAAGCTGAGGTGGGAGGG - Intronic
1083798756 11:65034311-65034333 CTTGGGAGGCTGAGGCGGGAGGG + Intronic
1083809026 11:65092440-65092462 CTTGGGAGGCTGAGGCGGGAGGG + Intronic
1084133392 11:67155544-67155566 CCTGAGAGGCTGAGGCAGGAGGG - Intronic
1084457473 11:69276640-69276662 CTTGAGAGGCAGAAGCTGGAGGG - Intergenic
1084626521 11:70312084-70312106 TTTGAGAAGCTGAGGCAGGCAGG - Intronic
1084638781 11:70411867-70411889 CTTGAAAAGCCCAGCCCGGAGGG - Intronic
1085674151 11:78499371-78499393 CTTGGAAGCCTGAGGCAGGAGGG - Intronic
1085971985 11:81604172-81604194 CTTGAGAAGATGAGTCTTGAGGG + Intergenic
1086177397 11:83907943-83907965 CTTGGGAAGCTGAGGAGGGATGG - Intronic
1086383375 11:86283024-86283046 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1087110068 11:94456002-94456024 CTTGAGAGGCTAAGGTTGGAGGG - Intronic
1087162379 11:94961335-94961357 CTTCAAAAGCTGATGCTGATTGG - Intergenic
1087392817 11:97560206-97560228 TTTGGGAGGCTGAGGCTGGAGGG - Intergenic
1087642579 11:100771365-100771387 CTTTAAAAGGTGGGGGTGGAGGG - Intronic
1087802344 11:102517903-102517925 CTTGGAAGGCTGAGGTGGGAGGG - Intergenic
1088214846 11:107496602-107496624 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1088285171 11:108180217-108180239 CTTGGGAAGCTGAGGTGGGAGGG + Intronic
1088371747 11:109096442-109096464 TTTGAAAGGCCGAGGCAGGAGGG - Intergenic
1088453887 11:110013506-110013528 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1088644312 11:111904543-111904565 CTTGGGAAGCTGAGGCAGGAAGG + Intergenic
1089422490 11:118342276-118342298 TTTGAGAGGCTGAGGCAGGAGGG - Intronic
1089517648 11:119043965-119043987 CTTGGGAGACTGAGGCTGGAGGG - Intergenic
1090049053 11:123361160-123361182 GTGGAAAAGCAAAGGCTGGAAGG - Intergenic
1090078870 11:123597332-123597354 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1090477020 11:127032291-127032313 CTTGGGAGGCTGAGGCGGGAGGG + Intergenic
1091682289 12:2535596-2535618 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1092215869 12:6681977-6681999 TTTGTAAAGCTATGGCTGGAAGG - Intronic
1092391264 12:8082101-8082123 CTGGAAACGATGAGGCTGCACGG - Intergenic
1092624315 12:10310225-10310247 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1092682834 12:11006488-11006510 CTTGGCAAGCTGAGGCAGGAAGG - Intronic
1092730030 12:11522666-11522688 TTTGGGAAGCTGAGGCAGGATGG + Intergenic
1093047171 12:14460711-14460733 CTGTAGAAGCTGAGGCTGGGAGG - Exonic
1093177881 12:15933810-15933832 TATGAAAAGATGAGGCTGGTCGG - Intronic
1093564207 12:20582434-20582456 CTTGGAAGGCTGAGGCGGGCAGG - Intronic
1093832805 12:23784972-23784994 CTTGATAAGCTGAGGTGGGAGGG + Intronic
1093955849 12:25217784-25217806 CTCAAAAGGCTGAGGCAGGAGGG + Intronic
1094109976 12:26852193-26852215 TTTGAAAAGCTGAGGCAGGTGGG - Intergenic
1094129477 12:27060113-27060135 CTCGAGAGGCTGAGGCAGGAGGG - Intronic
1094487185 12:30934360-30934382 CCAGAGAAGCTGAGCCTGGATGG - Intronic
1094650340 12:32369796-32369818 TTTGGGAAGCTGAGGTTGGAGGG + Intronic
1094820576 12:34221000-34221022 CTTGGGAGGCTGAGCCTGGAGGG - Intergenic
1095394162 12:41743453-41743475 CTTGGGAAGCTGAAGCAGGAGGG - Intergenic
1095616389 12:44194721-44194743 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1096332544 12:50726741-50726763 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1096390953 12:51228785-51228807 CTTGAGAGGCTGAGGCAAGAGGG - Intergenic
1096664623 12:53155012-53155034 TTTGGAAGGTTGAGGCTGGAAGG + Intergenic
1097116493 12:56701264-56701286 CTTGGGAGGCTGAGGCTGGAAGG - Intergenic
1097328268 12:58303933-58303955 TTTGGAAAACTGAGGCAGGATGG - Intergenic
1097683817 12:62673831-62673853 CTTGAAAGGCTGAGATGGGAGGG - Intronic
1097885459 12:64724559-64724581 CTTAAAAAGCTCATGCTGGCTGG + Intronic
1098459514 12:70716737-70716759 CTTGGAAGGCTGAGGCAGGAAGG + Intronic
1099058445 12:77874451-77874473 TTTGAGAGGCTGAGGCAGGAAGG - Intronic
1099213960 12:79831287-79831309 ATTGAAAAGAGGAGGCTGGGTGG + Intronic
1099468833 12:83021485-83021507 CTTGGGAAGCTGAGTCGGGAGGG + Intronic
1099722029 12:86376093-86376115 ATTGAAAAAATGAGGCTGTAGGG + Intronic
1100485526 12:95022800-95022822 CTTGGGAGGCTGAGGCGGGAAGG - Intronic
1101134154 12:101722608-101722630 TTTGAGAAGCTGAGGCTGGGAGG + Intronic
1101316343 12:103632498-103632520 CTTGGGGAGCTGAGGCTGGTGGG + Intronic
1101679656 12:106953294-106953316 CTTGGGAAGTTGAGGCAGGAAGG - Intergenic
1101778284 12:107813836-107813858 CTTGGAAAGCTGAGGTGGGAGGG + Intergenic
1101928355 12:108991836-108991858 CTCAAAAGGCTGAGGCAGGAGGG + Intronic
1101946625 12:109142139-109142161 CTTGAGAGGCTGAAGCAGGAGGG + Intronic
1102147321 12:110664160-110664182 CTCGGGAAGCTGAGGCTGGAAGG - Intronic
1102304116 12:111791792-111791814 CTTGGAAGGCCGAGGCAGGAGGG + Intronic
1102571722 12:113830846-113830868 GTTGGAAAGCAGAGGCTGAAAGG + Intronic
1102671651 12:114624367-114624389 CTTGGAAGGCTGAGGTGGGAGGG + Intergenic
1102694757 12:114790193-114790215 CTTGAGAGGCTGAGGTTAGAAGG - Intergenic
1102879387 12:116472612-116472634 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1102978221 12:117221751-117221773 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1103092544 12:118107591-118107613 CTTGAAAGGCTGAGGCAGGAGGG + Intronic
1103292111 12:119855014-119855036 CTTAAGAGGCTGAGGCGGGAGGG + Intronic
1103460609 12:121101800-121101822 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1103659395 12:122501354-122501376 CTCGGCAAGCTGAGGCGGGAGGG + Intergenic
1104007306 12:124902676-124902698 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1104192040 12:126491270-126491292 CTTGGGAAGCTGAGGTGGGAGGG - Intergenic
1104872469 12:132009769-132009791 TTTGGGAAGCTGAGGCAGGAGGG - Intronic
1105035900 12:132920776-132920798 CTTGGGAAGCTGAGGCAGAAGGG - Intronic
1105208553 13:18243279-18243301 CTTGGCAGGCTGAGGCAGGAGGG + Intergenic
1105392814 13:19996776-19996798 CTTGGGAGGCTGAAGCTGGAAGG + Intronic
1105796346 13:23857460-23857482 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1105971939 13:25437017-25437039 TTTGGGAAGCTGAGGCTGGTGGG - Intronic
1106234187 13:27847864-27847886 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1107018194 13:35725555-35725577 TTTGAGGGGCTGAGGCTGGACGG + Intergenic
1107202405 13:37737579-37737601 CTTGTGAAGCTGAGGTGGGAGGG - Intronic
1108025125 13:46169690-46169712 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1108584657 13:51859998-51860020 CTTGGAAGGCTGAGGAAGGAAGG - Intergenic
1110848174 13:80213381-80213403 CTTGGAAGGCTGAGGCAGGAGGG + Intergenic
1111299762 13:86332535-86332557 TTTGAGAGGCTGAGGCTGGTGGG - Intergenic
1111571915 13:90100060-90100082 CTTGGAAGGCTGAGGTAGGAGGG + Intergenic
1111701013 13:91689058-91689080 CTTGGGAAGTTGAGGCAGGAGGG + Intronic
1111802633 13:92998971-92998993 GTTGGGAGGCTGAGGCTGGAGGG + Intergenic
1111883235 13:93985327-93985349 CTTGAGAGGCTGAGGCAGGAAGG + Intronic
1111915569 13:94356792-94356814 CTTGGAAGGTTGAGGCGGGAGGG + Intronic
1112036500 13:95501419-95501441 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1112277562 13:98035484-98035506 CTTGAGAGGCTGAGGCGAGAAGG + Intergenic
1112318048 13:98382117-98382139 CTTGGGAAGCTGAGGTGGGAGGG + Intronic
1112336398 13:98520683-98520705 CTTGGAGAGCTGTGGCTGGGTGG - Intronic
1112351546 13:98639099-98639121 TTTGGGAGGCTGAGGCTGGAGGG + Intergenic
1112845048 13:103631699-103631721 GTTGAGAGGCTGAGGCAGGAGGG + Intergenic
1112879920 13:104094394-104094416 CTTGTGAAGCTAAGGCTTGATGG - Intergenic
1112903242 13:104385735-104385757 CTTGGGATGCTGTGGCTGGAGGG - Intergenic
1113626515 13:111851994-111852016 TTTGGGAAGCTGAGGCAGGAGGG + Intergenic
1114164560 14:20206935-20206957 CTTGATAAGCTCAGGCTTTATGG + Intergenic
1114287761 14:21261068-21261090 ATTGGAAGGCTGAGGCAGGAGGG - Intronic
1114401985 14:22418515-22418537 ATGGAAGAGCTGAGGGTGGAAGG - Intergenic
1114423008 14:22600311-22600333 CTTGAAAAGCTGAGGCTGGAAGG + Intronic
1114446467 14:22792453-22792475 CTTGGAAGGCTGAGGTGGGAAGG + Intronic
1115215099 14:31006310-31006332 TCTGAAAGGCTGAGGCAGGAGGG + Intronic
1115403546 14:32991076-32991098 CTTGGAAGGCTGAAGCAGGAGGG - Intronic
1115483198 14:33883039-33883061 CTTGAAAGGCTGAGGTGGGTGGG - Intergenic
1115709099 14:36030392-36030414 CATGAAAAGCTATGGCTGGCCGG + Intergenic
1116065147 14:39972726-39972748 CTGGAAAGTCTGAGGCTTGAGGG + Intergenic
1117373343 14:55098657-55098679 TTTGGGAAGCTGAGGCAGGAAGG + Intergenic
1117530105 14:56652388-56652410 CTTGAGAGGCTGAGGCAGGAGGG + Intronic
1117696649 14:58371171-58371193 CTTGGAAGGCTGAGGCAGGAGGG + Intronic
1118214296 14:63793828-63793850 CTTGAGAGGCTGAGGTTGGGAGG + Intergenic
1118214772 14:63798499-63798521 CTCGAGAGGCTGAGGCAGGAGGG - Intergenic
1118514565 14:66510790-66510812 CTTGAAAAGCTGAAGTGGAATGG + Intronic
1118633008 14:67723339-67723361 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1118650550 14:67888466-67888488 CTTGAGTAGCTGAGACTGCAGGG - Intronic
1118715828 14:68559486-68559508 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1118724911 14:68622115-68622137 CTAGAACAGATGGGGCTGGATGG - Intronic
1118765506 14:68906878-68906900 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1119268114 14:73277084-73277106 CTTGGAAAGGTGATGCTGGCTGG + Exonic
1119303050 14:73585895-73585917 CTTGGGAGGCTGAGGCAGGAAGG + Intergenic
1119443073 14:74641850-74641872 CTTGCCAAGCTGAGACTGGCTGG + Intergenic
1119765178 14:77183300-77183322 GCTGAGAAGCTGAGGCTGCAAGG + Intronic
1119945790 14:78692591-78692613 CTTGAAACTATGAGGCTGTATGG - Intronic
1120002842 14:79323139-79323161 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1120061608 14:79989948-79989970 CTTGGGAAACTGAGGCAGGAGGG - Intergenic
1120472360 14:84942126-84942148 CTTGAGAACCTTAGGCAGGAGGG - Intergenic
1120802839 14:88711835-88711857 CCTGGGAAGCTGAGGCAGGAGGG + Intronic
1121064007 14:90944371-90944393 TTTGGAAGGCTGAGGCAGGAGGG + Intronic
1121348772 14:93156337-93156359 TTTAAAAAGCTGAGGCAGAATGG + Intergenic
1121366271 14:93313986-93314008 TTTGCAAAGCTGAGGCAGGAAGG - Intronic
1121749729 14:96340808-96340830 CTTGCGAGGCTGAGGCGGGAGGG + Intronic
1122391556 14:101391328-101391350 TTTGGGAAGCTGAGGCAGGAGGG - Intergenic
1202927185 14_KI270724v1_random:37379-37401 TTTGAAAGGCAGATGCTGGAGGG - Intergenic
1123681187 15:22765437-22765459 CTTGAGAGGCTGAGGCAAGAAGG - Intergenic
1123758125 15:23412733-23412755 CCTGAAAAGTTGAGGCTATAGGG + Intergenic
1123805597 15:23869189-23869211 CCTGAAAAGCTGAATCTGAAAGG - Intergenic
1124333400 15:28839899-28839921 CTTGAGAGGCTGAGGCAAGAAGG - Intergenic
1124908781 15:33897772-33897794 CTTGAGAGGCTGAGGTAGGAGGG + Intronic
1124950545 15:34315477-34315499 CTTAGGAAGCTGAGGCAGGAGGG + Intronic
1125386109 15:39138615-39138637 CTTGGGAAGCTGAGGTGGGAAGG - Intergenic
1125431467 15:39599031-39599053 CTTGGGAGGCTGAGGCAGGAGGG - Exonic
1125783849 15:42297403-42297425 CTTGGGAGGCTGAGGCTAGAGGG - Intronic
1125987871 15:44073024-44073046 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1125992932 15:44127762-44127784 CTTGGAAGGCTGAGGTGGGAGGG + Intronic
1126015199 15:44344015-44344037 CTGGATAGGCTGAGGCGGGAGGG + Intronic
1126450841 15:48807127-48807149 TCTGAGAAGCAGAGGCTGGAGGG - Intronic
1126752976 15:51895998-51896020 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1126791215 15:52222861-52222883 CTTGAAAAGGTGAGATTTGAAGG + Intronic
1126815549 15:52449891-52449913 CTTAGAAAGCTGAGGTTGGGAGG + Intronic
1126969968 15:54099731-54099753 CTTGAAAAACTTAGAGTGGATGG - Intronic
1127054972 15:55121953-55121975 CTTGGGAAGCTGAGGCAGAATGG + Intergenic
1127271698 15:57407563-57407585 CTTGAGAGGCTGAGGCAGGAGGG + Intronic
1127599618 15:60522465-60522487 TTTGAGAGGCTGAGGCAGGAAGG + Intronic
1128071032 15:64797360-64797382 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1128139682 15:65290065-65290087 CTTGAAAAGCTCCTGCTGGCCGG - Intronic
1128224192 15:65990306-65990328 TTTGAAAGGCTGAGGCAGAAGGG + Intronic
1128283574 15:66417461-66417483 CTTGAGAAACTGAGGTGGGAGGG + Intronic
1128305813 15:66598286-66598308 CTTGAAAGCCTGAGGGTGGAAGG + Intronic
1128641969 15:69345823-69345845 CTTGGGAAGCTGAGGCGAGAAGG + Intronic
1129006607 15:72378909-72378931 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1129011752 15:72424855-72424877 GTGGCAAAGATGAGGCTGGAAGG + Intergenic
1129289616 15:74554408-74554430 CTTGGGAGGCTGAGGCGGGAGGG - Intronic
1129835021 15:78697795-78697817 CTTGAAAAACTGAGAATAGAAGG - Intronic
1129912639 15:79241056-79241078 CCAGAAAAGCTGAGCCTGGAAGG + Intergenic
1129915632 15:79267467-79267489 TTTGAGTAGCTGAGGCAGGAAGG + Intergenic
1130013688 15:80171830-80171852 CTTGAAAGGCAAAGGCTGTATGG + Intronic
1130136678 15:81187485-81187507 CTTGGAAGGCCGAGGCAGGAGGG + Intronic
1130180636 15:81624309-81624331 CTTGGAAGGCTGAGGCGAGAAGG - Intergenic
1130580355 15:85132212-85132234 CTTGAGAGGCTAAGGCAGGAGGG - Intronic
1130684652 15:86026059-86026081 CTTGGGAAGCTGAGGCAGGGGGG + Intergenic
1130936525 15:88475563-88475585 CTTGGGAGGCTGAGGCTGGATGG + Intronic
1131040922 15:89266102-89266124 CTTGGGAAGCAGAGGCTGGAGGG - Intronic
1131416184 15:92260646-92260668 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1131904955 15:97133177-97133199 TTTGAGAAGCTGAGGTGGGAGGG - Intergenic
1132311380 15:100860530-100860552 CATGAAGAGCTGGGGGTGGAGGG - Intergenic
1132461530 16:57716-57738 CCCTAAAGGCTGAGGCTGGAGGG - Intergenic
1132784059 16:1644699-1644721 AGTGCAGAGCTGAGGCTGGAGGG + Intronic
1132811682 16:1802160-1802182 TTTGGGAGGCTGAGGCTGGAGGG + Intronic
1133072852 16:3257928-3257950 CTTGGGAGGCTGAGGTTGGAGGG - Intergenic
1133190315 16:4128979-4129001 CTTGGGAGGCTGAGGTTGGAAGG - Intergenic
1133213648 16:4277245-4277267 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1133342835 16:5048134-5048156 CTTGGTAGGCTGAGGCAGGAAGG - Intronic
1133602620 16:7354544-7354566 TTTGAAAAGCTGAGTTTAGAAGG - Intronic
1133653825 16:7839765-7839787 CTAGTACAGCAGAGGCTGGAAGG - Intergenic
1134002957 16:10796945-10796967 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
1134636149 16:15793533-15793555 CTTGAGAGGCCGAGGCGGGAGGG - Intronic
1134646582 16:15872591-15872613 CTTGGGAAGCTGAGGCAAGAAGG + Intronic
1135303469 16:21350053-21350075 CTTGGAAAGCCGAGGCCGGCCGG + Intergenic
1135529388 16:23239665-23239687 CTTGAGAAGCTGAGGTAGGAGGG - Intergenic
1135643493 16:24141624-24141646 CTAGAAAAGATGAGTTTGGAAGG + Intronic
1135892154 16:26366905-26366927 TCAGAAAAGCTGAGGCTGGGAGG + Intergenic
1136059157 16:27712911-27712933 CTTGAGAGGCTGAGGTTGGGGGG - Intronic
1136251865 16:29010652-29010674 CTTGGAAAGCTGAGGCAGGAGGG + Intergenic
1136300216 16:29329247-29329269 CTTGGAAAGCCGAGGCCGGCCGG + Intergenic
1136463368 16:30425699-30425721 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1136466192 16:30445538-30445560 CATGAAGGGCTGAGGCTGCAAGG - Exonic
1136604261 16:31322207-31322229 CTTGAGAGGCTGAGGTGGGAGGG + Intronic
1136785049 16:32929396-32929418 TTTGGGAAGCTGAGGCTGGCAGG - Intergenic
1136872189 16:33817367-33817389 CTTGGAAGGTTGAGGCTTGAGGG + Intergenic
1136884734 16:33924408-33924430 TTTGGGAAGCTGAGGCTGGCAGG + Intergenic
1137734094 16:50711489-50711511 CTTGGGAAGCTGAGTCTGGGGGG - Exonic
1138195248 16:55047073-55047095 ATTGTAAAGCTTAGGCTGGTGGG + Intergenic
1138447513 16:57073699-57073721 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1138686399 16:58729828-58729850 CTTAAAAGACAGAGGCTGGAGGG - Intronic
1139208988 16:65057752-65057774 ATTGAGAAACTGAGGCTGAATGG + Intronic
1139374882 16:66490833-66490855 TCTGAAAAGCTGAGATTGGAGGG - Intronic
1139407853 16:66733595-66733617 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1139618579 16:68117613-68117635 CCTGAGAGGCTGAGGCAGGAGGG - Intronic
1139787018 16:69401587-69401609 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1140115677 16:72039413-72039435 TTGGAGAAGCTGCGGCTGGAGGG + Intergenic
1140137676 16:72222213-72222235 CTTGAGAAGGTGAGGCAGGAAGG - Intergenic
1140246249 16:73252615-73252637 CTTCAAAAGCTCAGGGTGGGAGG + Intergenic
1140700597 16:77578055-77578077 TTTGGGAAGCTGAGGCTGGCAGG + Intergenic
1140894011 16:79309173-79309195 CAGGAAAAACTGAGGCTGAAGGG + Intergenic
1141183189 16:81768671-81768693 CTCGGAAGGCTGAGGCAGGAGGG - Intronic
1141431270 16:83971404-83971426 CTTGCCAGGCTGAGGCTCGAAGG - Intronic
1141588604 16:85051894-85051916 TTTGGGAGGCTGAGGCTGGAGGG - Intronic
1142173463 16:88634550-88634572 CTGGAAAAGCGGCGGCAGGAAGG - Intergenic
1142332980 16:89467468-89467490 CTTGGGAGGCTGAGGCTGGATGG - Intronic
1142359156 16:89618608-89618630 CTTGGGAAGCTGAGGTGGGAAGG - Intronic
1203087709 16_KI270728v1_random:1193405-1193427 TTTGGGAAGCTGAGGCTGGCAGG - Intergenic
1203099983 16_KI270728v1_random:1298701-1298723 CTTGGAAGGTTGAGGCTTGAGGG - Intergenic
1142655983 17:1394496-1394518 CTAGGGAAGCTGAGGCAGGAGGG + Intronic
1142826650 17:2516713-2516735 CTTGGAAGGCTGAGGCAGGTAGG + Intergenic
1143071464 17:4298215-4298237 CTTGAGAGGCTGAGGGGGGAAGG + Intronic
1143481201 17:7228169-7228191 CTAGAGAAGGTGAGGGTGGAAGG + Intronic
1143513828 17:7409450-7409472 CTTGGAGTGCTGAGGATGGAGGG - Intronic
1144102691 17:11957055-11957077 CTTGAAAAAATCAGGATGGAAGG + Intronic
1144547492 17:16211348-16211370 CTTGGGAAGCTGAGCCTGGGAGG - Intronic
1145231183 17:21174509-21174531 ATTGAAAAGCTGATATTGGAAGG - Intronic
1145985120 17:29040769-29040791 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1146041279 17:29457205-29457227 CTTGGAAGGCTGAGGTGGGAGGG - Intronic
1146067701 17:29649492-29649514 CTTGGAAAGCTGAGGGAGGTGGG - Intronic
1146099112 17:29961694-29961716 CTTGGGAAGCTGAGGTAGGAGGG - Intronic
1146376298 17:32296960-32296982 CTAGAGAAGCTGAGGCTGGCAGG - Intronic
1146409469 17:32570143-32570165 CGTGAGACTCTGAGGCTGGAAGG - Intronic
1146421105 17:32686755-32686777 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1146756056 17:35432855-35432877 AATGAAAAACTAAGGCTGGAAGG + Intronic
1146773358 17:35589015-35589037 CTGGAAAACCTAAGGCTAGAAGG - Intronic
1146832222 17:36080014-36080036 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1146999120 17:37347658-37347680 TTTGGAAGGCTGAGGCAGGAGGG + Intronic
1147663830 17:42132774-42132796 ATTGGGAAGCTGAGGCGGGAGGG - Intronic
1147680871 17:42244385-42244407 CTAGAAATTCTGAGGCTGGCTGG - Intronic
1147724881 17:42560892-42560914 CTTGAAAGGCTGAGTGTGGAGGG - Intergenic
1147740301 17:42667615-42667637 CTGGAATCCCTGAGGCTGGAGGG - Intergenic
1147948666 17:44094901-44094923 CTTGGGAAGCTGAGGTGGGAGGG - Intronic
1148002047 17:44394600-44394622 CTTGAAAGGCTGAGGTTGAGAGG + Intergenic
1148249141 17:46059509-46059531 CTTGGAAGGCTGAGGCAGGAAGG + Intronic
1148351410 17:46944363-46944385 CTTAGAAAGCTGAGGCTGAGAGG - Intronic
1148477757 17:47940562-47940584 CTTAAATAAATGAGGCTGGAGGG + Intergenic
1148770973 17:50066134-50066156 CTTGGGAGGCTAAGGCTGGAGGG - Intronic
1149192971 17:54086040-54086062 CCTGAAATGCTGCAGCTGGATGG + Intergenic
1149292464 17:55230477-55230499 CAGGAAAACCTGTGGCTGGAGGG - Intergenic
1149443759 17:56697897-56697919 CTTGTAAGGCTGAGGCAGGAAGG - Intergenic
1149476415 17:56964790-56964812 CTTGAAAAGCTGAACTGGGAGGG - Intergenic
1149540885 17:57467309-57467331 CTTGAAAAGCATTGGATGGATGG + Intronic
1149740806 17:59044050-59044072 TTTGGGAAGCCGAGGCTGGAGGG + Intronic
1149786421 17:59439391-59439413 TTTGAGAAGCTGAGGTGGGAGGG - Intergenic
1149864671 17:60144618-60144640 TTTGAGAGGCTGAGGCAGGAAGG - Intergenic
1149871689 17:60188086-60188108 CTTGGGAGGCTGAGGTTGGAGGG - Intronic
1149884257 17:60325304-60325326 CTTGGAAGGCTGAGGTGGGAGGG + Intronic
1150049695 17:61949335-61949357 CATGAAAAGCTGGGGCAGGAGGG - Intronic
1150666781 17:67147583-67147605 CTTGAGAGGCTGAGGTGGGAGGG - Intronic
1151213701 17:72563052-72563074 CTTGAAAACCTGAGGCTGAGAGG - Intergenic
1151490266 17:74428707-74428729 CTCGAGAGGCTGAGGCAGGAGGG + Intronic
1151903388 17:77032603-77032625 CTTGAGAGGCTGAGGTGGGAGGG - Intergenic
1152688867 17:81708433-81708455 CCAGGAAAACTGAGGCTGGAGGG - Intergenic
1153211886 18:2776327-2776349 CTTGGGAAGCTGAGGTGGGAAGG - Intronic
1153273560 18:3346892-3346914 CTTGAGAGGCTGAGGCAGGAGGG + Intergenic
1153283402 18:3435302-3435324 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1153303908 18:3615288-3615310 GTAGAAAAGCTGGGACTGGAAGG + Intronic
1153623837 18:7004820-7004842 TTTGAAAAACTGAGGATGGAAGG + Intronic
1153835986 18:8964368-8964390 CTTGGGAGGCTGAGGCGGGAGGG + Intergenic
1153907402 18:9674624-9674646 CTTGTTAAGCTCATGCTGGAAGG - Intergenic
1154195188 18:12260426-12260448 TTTGGAAGGCTGAGGCAGGAGGG - Intronic
1154200472 18:12296386-12296408 TTTGAAATTCTGAGCCTGGAAGG + Intergenic
1155044396 18:22091077-22091099 TTTGAGAGGCTGAGGCAGGAGGG + Intronic
1155298791 18:24409807-24409829 CATGGGAAGCTGAGGCTGGAGGG + Intergenic
1155309591 18:24510617-24510639 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1155484160 18:26323464-26323486 CTGGAAAGGCTGAGGTGGGAGGG - Intronic
1155712768 18:28903454-28903476 CTTTAAAAGATGAAGCTAGAAGG + Intergenic
1155972589 18:32095275-32095297 CTTGAGAGGCTGAGGCGGGAGGG - Intronic
1156815408 18:41305117-41305139 TTTGAAAGGCTGAGGCAGGCAGG + Intergenic
1157344761 18:46816565-46816587 CTTGCGAAGCTGAGGCCAGAAGG - Intronic
1157398386 18:47364101-47364123 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1157759767 18:50252649-50252671 TTTGGAAGGCTGAGGCAGGAGGG - Intronic
1157885262 18:51360392-51360414 TTTGGAAAGCTGAGGCGGGTGGG - Intergenic
1157898087 18:51487337-51487359 CTGGAGAAGCTGAGGCTGAGTGG - Intergenic
1158509226 18:58075681-58075703 TTTGGAAGGCTGAGGCGGGAGGG + Intronic
1158513196 18:58109676-58109698 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1158561311 18:58516109-58516131 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1159908236 18:74118103-74118125 CTTGAGAGGCTGAGGGTGGGAGG - Intronic
1160921644 19:1523631-1523653 CATGAAAACCTGGGGCTTGATGG - Intergenic
1161037275 19:2092206-2092228 CTTGAGAGGCTGAGGTGGGAGGG - Intronic
1161263860 19:3353819-3353841 TTTGGGAAGCTGAGGCAGGAGGG + Intergenic
1161386306 19:3995397-3995419 CTTGGGATGCTGAGGCAGGAGGG + Intergenic
1161425521 19:4200627-4200649 CTTGGGAGGCTGAGGTTGGAGGG - Intronic
1161552304 19:4920659-4920681 CTTGGCAGACTGAGGCTGGAGGG - Intronic
1161691806 19:5739730-5739752 CTTGGAAGGCTGAGGTGGGAGGG + Intronic
1161720999 19:5902664-5902686 CATGAAACGCTCAGGCTGGAAGG + Intronic
1161721675 19:5906071-5906093 CTTGAGAGGCTGAGGAGGGAGGG - Intronic
1161823666 19:6547287-6547309 GATGAGAAGCTGAGGCAGGAAGG + Intergenic
1162350083 19:10143321-10143343 CTTGGGAGGCTGAGGCTGAAGGG - Intronic
1162355367 19:10180202-10180224 CTTGGGAGGCTGAGGCAGGAGGG + Exonic
1162454376 19:10774195-10774217 CCTGAAAGGCTGAGTCAGGAGGG + Intronic
1162755932 19:12859942-12859964 TTTGGAAGGCTGAGGCAGGACGG - Intronic
1162832697 19:13296865-13296887 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1163002524 19:14376891-14376913 CTTGGGAGGCTGAGGCGGGAGGG + Intergenic
1163171000 19:15530997-15531019 TTTGGGAAGCTGAGGCAGGAGGG + Intronic
1163181972 19:15610512-15610534 CTCGAGAGGCTGAGGCAGGAAGG + Intergenic
1163212227 19:15849567-15849589 TTTGAAAAGCCGAGGCGGGCAGG - Intergenic
1163315832 19:16539927-16539949 CTCAAGAGGCTGAGGCTGGAGGG - Intronic
1163326356 19:16605835-16605857 AATGAACAGCTGAGGCTGCATGG + Intronic
1163641108 19:18462622-18462644 TTTGGAAAGCTGAGGTGGGAGGG - Intronic
1163751483 19:19080810-19080832 CTTGGGAAGCTAAGGCAGGAGGG + Intronic
1163916628 19:20246030-20246052 CTTTAATAGCTGTGGCTGGCAGG - Intergenic
1164437914 19:28248059-28248081 CTGGAAAGGCTGAGGTGGGAGGG + Intergenic
1164960465 19:32424210-32424232 CTTGGGAAGCTGAGGCAGGAGGG + Intronic
1165088103 19:33365329-33365351 CTTGGAAGACTGAGGCGGGAGGG - Intergenic
1165161537 19:33819809-33819831 CTTAAAAAGCAGAGCCTGGGAGG + Intergenic
1165258439 19:34593992-34594014 CTTGGAGAGGTGAGGCAGGAGGG + Intronic
1165280768 19:34795380-34795402 CTTGGAAGGCTGAGGCAGGAGGG - Intergenic
1165377484 19:35453062-35453084 CTTGGGAGGCTGAGGCGGGAGGG - Intergenic
1165457476 19:35921628-35921650 TTTGGGAAGCTGAGGCGGGAGGG + Intergenic
1165832696 19:38737124-38737146 TGGGCAAAGCTGAGGCTGGAGGG - Intronic
1165885930 19:39078312-39078334 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1166095362 19:40535298-40535320 TTTGGAAGGCTGAGGCGGGAGGG - Intronic
1166676215 19:44742615-44742637 TTTGAGAGGCTGAGACTGGAGGG - Intergenic
1166687130 19:44802090-44802112 TTTGAAGATCTGAGGGTGGAGGG - Intergenic
1166894103 19:46012957-46012979 CTGGGAAGGCTGAGGCAGGAAGG - Intronic
1166928060 19:46283024-46283046 TTTGGAAGGCTGAGGCAGGAGGG + Intergenic
1167082848 19:47289066-47289088 TTTGAAAGGCTGAGGTGGGAGGG + Intergenic
1167109591 19:47451414-47451436 CTCGAGAGGCTGAGGCAGGAGGG - Intronic
1167176543 19:47868383-47868405 CTTGGAAGGCTGAGGCAGGAGGG + Intergenic
1167480807 19:49729841-49729863 CTTGGGAGGCTGAGGCCGGAGGG - Intergenic
1167626609 19:50594200-50594222 TTTGGAAGGCTGAGGCGGGAGGG - Intergenic
1167769915 19:51508659-51508681 CTGGAGCATCTGAGGCTGGAAGG - Intergenic
1167830654 19:52018974-52018996 CTTGAGAGGCTGAGGTGGGAAGG - Intronic
1167926448 19:52825019-52825041 CCTGAAATGCAGAGGCTGCAGGG + Intronic
1167962399 19:53116721-53116743 CTTGGAAAGCTAAGGTTGGAGGG - Intronic
1168445768 19:56411180-56411202 CTTGAGAGGCTGAGGTTGGGAGG + Intronic
1168522032 19:57059162-57059184 GTAGAAAAGATGAGGCAGGAGGG - Intergenic
1202702444 1_KI270712v1_random:174727-174749 GTTGAAAAGCAGTGTCTGGACGG - Intergenic
925196189 2:1928059-1928081 ACTCAAAAGCTGAGGCGGGAGGG - Intronic
925450749 2:3967468-3967490 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
925770520 2:7278193-7278215 TTTGAGAAGCTGAGGTAGGAGGG + Intergenic
926200074 2:10788546-10788568 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
926289728 2:11518990-11519012 CTTGGGAGGCTGAGGCAGGATGG + Intergenic
926290824 2:11528607-11528629 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
926397635 2:12460368-12460390 CTTGGGAAGCTGAGGTGGGAGGG + Intergenic
926414920 2:12640076-12640098 GTTGACAAGCTGAGGCTGGGAGG + Intergenic
926888321 2:17617760-17617782 CCTGACAAGCTGAGGATGAACGG - Intronic
926895148 2:17678666-17678688 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
928434346 2:31244442-31244464 CTTGAACAGGTGAGTGTGGAGGG + Exonic
928589252 2:32797285-32797307 CTTAGGAAGCTGAGGCAGGAGGG - Intronic
928873527 2:36010405-36010427 CTTGAAAAGCTAAGATGGGAGGG + Intergenic
929149849 2:38737766-38737788 CTTAGGAGGCTGAGGCTGGAGGG - Intronic
929245667 2:39699697-39699719 CTTGAGAAGCTGAGGTGGGAGGG - Intronic
929273618 2:40001464-40001486 CTTGAGAGGCTGAGGCAGAACGG - Intergenic
929477658 2:42268542-42268564 CTTGGAAGGCTGAGGCAGGAGGG - Intronic
929719011 2:44347225-44347247 CTTGGGAAGCTGAGGTGGGAGGG + Intronic
929754186 2:44750262-44750284 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
929819268 2:45260303-45260325 CCTGAAAGGAAGAGGCTGGAAGG - Intergenic
929854898 2:45628647-45628669 TTTGGAAGGCTGAGGCAGGAGGG - Intergenic
929904808 2:46036480-46036502 CTTGAGAGGCTGAGGTGGGAGGG + Intronic
929924670 2:46198306-46198328 ATGGAAAAGCTGAGGCAGGAAGG - Intergenic
930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG + Intergenic
930761823 2:55046899-55046921 GTTGGAATGCTGAGGTTGGAAGG - Intronic
930950095 2:57130618-57130640 CTTGAAAAGCTGTTGTTGAATGG + Intergenic
930967178 2:57343574-57343596 CTTGGGAGGCTGAGGGTGGATGG + Intergenic
931034975 2:58230408-58230430 CTTGAGAGGCTGAGGCGGGAGGG - Intronic
931215459 2:60238426-60238448 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
931228080 2:60351328-60351350 TCTGCACAGCTGAGGCTGGAAGG - Intergenic
931269192 2:60686895-60686917 TTTGGGAAGCTGAGGCAGGAGGG + Intergenic
931305834 2:61027228-61027250 CTTGGGAAGCTGAGGTGGGAGGG + Intronic
931420252 2:62120828-62120850 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
931726214 2:65113396-65113418 CTTAGAAGGCTGAGGCAGGAGGG + Intronic
931851810 2:66258985-66259007 CTTGAAAGGCTGAGGTGGGAAGG - Intergenic
932129555 2:69175514-69175536 CTGGGGAGGCTGAGGCTGGAGGG + Intronic
932134039 2:69213047-69213069 TCTGAGAAGCTGAGGCAGGAGGG - Intronic
932171229 2:69558233-69558255 CTTGGAAGGCTGAGGTGGGAAGG + Intronic
932630280 2:73336023-73336045 CTTGGAAGGCTGAGGCAGGAAGG + Intergenic
933394896 2:81718668-81718690 CTGGCAAAGATGAGGCTTGAAGG - Intergenic
933481393 2:82861382-82861404 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
933665511 2:84961362-84961384 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
933703116 2:85270092-85270114 CTTGAAGCTCTGTGGCTGGAAGG + Intronic
933730325 2:85451454-85451476 CTTGGGAGGCTTAGGCTGGAGGG - Intergenic
933792670 2:85895562-85895584 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
933861027 2:86467916-86467938 CTGGAGAAGCTGAGGCAGGGGGG + Intronic
934082455 2:88480892-88480914 CTTGAAAACATGATGCTGGCTGG + Intergenic
934173355 2:89558181-89558203 GTTGAAAAGCAGTGTCTGGACGG - Intergenic
934283670 2:91632534-91632556 GTTGAAAAGCAGTGTCTGGACGG - Intergenic
934568105 2:95351735-95351757 TTTGAGAGGCTGAGGCGGGAGGG + Intronic
934876232 2:97923512-97923534 CTTGAGAGGCTGAGGGAGGAGGG + Intronic
935710274 2:105892591-105892613 TTTGGAAGGCTGAGGCTGGGAGG + Intronic
935834841 2:107038939-107038961 CTTGAAAAGCTTAGTTTGGCTGG - Intergenic
936005328 2:108882044-108882066 CTCGAGAAGCTGAGGCAGGAGGG + Intronic
936100034 2:109569184-109569206 TTTGAAAGGCTGAGGCAGGTGGG + Intronic
936293810 2:111249493-111249515 CTTGGGAGGCTGAGGCCGGAGGG - Intergenic
936471748 2:112805048-112805070 CTTGAGAGGCTGAGGCAGGAGGG + Intergenic
936912705 2:117609385-117609407 TTTGGGAAGCTGAGGCAGGAGGG + Intergenic
936932037 2:117799755-117799777 CTTGCAAAGCAGAGGCTGGGGGG - Intergenic
937157122 2:119728919-119728941 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
937210533 2:120266601-120266623 CTTGGGAAGCTGAGGTGGGAGGG + Intronic
937222690 2:120350895-120350917 CTTGAACTGCTGAGGATGGGGGG + Exonic
937276218 2:120685772-120685794 CTTGAGAAGCTGAGGCTGCAGGG - Intergenic
938012227 2:127838063-127838085 CTCGAGAGGCTGAGGCAGGAAGG - Intergenic
938014509 2:127856480-127856502 CTTGGGAGGCTGAGGCAGGATGG + Intronic
938172172 2:129088842-129088864 CTGGAAAATGTGAGGCTGGGAGG - Intergenic
939047050 2:137262028-137262050 CTGTAAAAGCTGAGGATGCAAGG + Intronic
939524568 2:143276688-143276710 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
939549671 2:143598661-143598683 TTTGGGAAGCTGAGGCGGGAGGG + Intronic
939983347 2:148806596-148806618 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
940746957 2:157578008-157578030 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
940858539 2:158749130-158749152 CTAGAAAGGCAGAGGCTGGGTGG - Intergenic
940888351 2:159010964-159010986 TGTGAAGAGCTGAGGATGGAAGG + Intronic
941101233 2:161297836-161297858 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
941197333 2:162468956-162468978 CTTGGGAAGCTGAGGAGGGAGGG - Intronic
941278319 2:163518333-163518355 CTTGAAAGACTGAAGCAGGAGGG + Intergenic
941495467 2:166195938-166195960 CTTGGGAGGCTGAGGCAGGAGGG + Exonic
941505627 2:166340726-166340748 CTTGAGAGGCTGAGGTGGGAGGG - Intronic
941959109 2:171236119-171236141 CTTGAGAGGCTGAGGTGGGAGGG + Intergenic
941986821 2:171518629-171518651 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
942005349 2:171694363-171694385 CTTGAAAAGAGGTGGCTGGGTGG + Intronic
942581360 2:177422127-177422149 CTGGAAGAGATGAGGCTGTAGGG + Intronic
943038835 2:182779499-182779521 CTTGAGAGGCTGAGGCAGGAGGG + Exonic
944237047 2:197450415-197450437 TTTGGAATGCTGAGGCAGGAGGG - Intergenic
944670482 2:201990236-201990258 CTTGGAAGGTTGAGGCAGGAGGG + Intergenic
944673043 2:202011964-202011986 CCTGGAAAGCTGAGGCCAGAGGG + Intergenic
944875018 2:203954479-203954501 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
945261080 2:207843973-207843995 CCTGGGAGGCTGAGGCTGGAGGG + Intronic
946214177 2:218170926-218170948 CATGGAAAGCTGAGGCAAGAGGG + Intergenic
946580364 2:221121682-221121704 CTTGGAAGGCTGAGGTGGGAGGG - Intergenic
947360858 2:229343881-229343903 CTTGAAAGGCTGCGACTGGTTGG - Intergenic
947467622 2:230367398-230367420 CTTGGACGGCTGAGGCAGGAGGG - Intronic
947858687 2:233342864-233342886 CTTCAGAAGCTGAGGTAGGAGGG - Intronic
948114565 2:235484850-235484872 CTTGGAAGGCTGAGGTGGGAGGG + Intergenic
948189452 2:236046527-236046549 CTTGAATAGCTGGGACAGGAGGG + Intronic
948932481 2:241141035-241141057 TTTGGAAGGCTGAGGCAGGAAGG + Intronic
1169068700 20:2708610-2708632 CTTGGAAGGCTGAGGCAGGAAGG + Intronic
1169153698 20:3311246-3311268 CTTGGAAGGCTGAGACTGGAGGG - Intronic
1169310271 20:4532133-4532155 CTTGCAAAGAAGAGGATGGAAGG - Intergenic
1169566325 20:6857218-6857240 TTTGCAAGGCTGAGGCAGGAAGG - Intergenic
1170035027 20:11981084-11981106 CTTGAAAGGCTGAGGTGAGAGGG - Intergenic
1170402809 20:16006051-16006073 CTTGAAAAGCCAATCCTGGAAGG + Intronic
1170531328 20:17295655-17295677 CTTGGAAGGCTGAGGCAGGAGGG - Intronic
1170589113 20:17757822-17757844 CTTGAAGAGCTGGGACTGGAGGG - Intergenic
1170614098 20:17935212-17935234 CTGGAACAGGTGTGGCTGGATGG + Intergenic
1170632377 20:18076570-18076592 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1171292948 20:23993097-23993119 CTTGGCAGGCTGAGGCAGGAAGG + Intergenic
1172555923 20:35841235-35841257 CTTGGGAGGCTGAGGCTGGAGGG + Intronic
1172737617 20:37139739-37139761 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
1172755195 20:37278829-37278851 CTTGAGATGCTGAGGCGGGAGGG + Intergenic
1173084449 20:39902429-39902451 TTTGGGAAGCTGAGGCTGGTGGG - Intergenic
1173088273 20:39945716-39945738 CTTGAGAGGCTGAGGTGGGAGGG + Intergenic
1173529753 20:43760252-43760274 CTTGGGAGGCTGAGGCGGGAAGG + Intergenic
1174015674 20:47486192-47486214 CTCAAGAGGCTGAGGCTGGAGGG + Intergenic
1174022594 20:47542852-47542874 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1174276453 20:49407956-49407978 CCTGGAAAGCGGAGGCTAGAGGG - Intronic
1174399106 20:50266393-50266415 CTCGGGAGGCTGAGGCTGGAGGG + Intergenic
1174478505 20:50814392-50814414 CTTGAGAGGCTGAGGTTGGGAGG - Intronic
1174488787 20:50877614-50877636 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1174589751 20:51635627-51635649 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
1174828214 20:53788447-53788469 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1174941019 20:54927230-54927252 CTTGAAAAGCTGAATATGGCTGG - Intergenic
1177291704 21:19121142-19121164 CTTGAAGAGCTGAGGTTGTTGGG - Intergenic
1177435403 21:21045539-21045561 CTCGGAAAACTGAGGCAGGAGGG + Intronic
1177489472 21:21803885-21803907 TTTGAGAGGCTGAGGCAGGAGGG + Intergenic
1177824607 21:26068465-26068487 CTTGGAAGGCTGAGACAGGAAGG - Intronic
1177837471 21:26200699-26200721 CTTGGGAGGCTGAGGCGGGAGGG - Intergenic
1177948605 21:27505103-27505125 CTTGGAAGGCTGAGACAGGAGGG + Intergenic
1178363213 21:31967241-31967263 CTTGGAAGGCTGAGGTGGGAAGG + Intronic
1178520847 21:33287464-33287486 TTTGAAAGGCTGAGGTGGGAGGG - Intronic
1178540396 21:33444679-33444701 CTCGGGAGGCTGAGGCTGGAGGG + Intronic
1178594395 21:33939943-33939965 CCTGAAAAGATGATGCTGGCCGG + Intergenic
1178642419 21:34355818-34355840 AAAGAAAAGCAGAGGCTGGAGGG + Intergenic
1178701304 21:34835591-34835613 CGTGCAAAGCTGAGGCTCCAAGG + Intronic
1178719475 21:34995546-34995568 CTTGAGAGGCTGAGGCAGGAGGG - Intronic
1178831217 21:36058391-36058413 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1178909857 21:36665826-36665848 CTTGGAGGGCTGAGGCAGGAGGG - Intergenic
1178950808 21:36983941-36983963 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1179205970 21:39278975-39278997 CTAGGGAGGCTGAGGCTGGAGGG - Intronic
1179261201 21:39759568-39759590 CTGAAAAAGCTGAGGCAGGCTGG + Intronic
1179929426 21:44557599-44557621 CTGGAGACGCTGAGGCTGGCAGG + Intronic
1180605342 22:17054842-17054864 CTTAGGAAGCTGAGGCAGGAGGG + Intergenic
1180616235 22:17129939-17129961 CTTGGAAGGCTGAGGCAGGAGGG - Intronic
1180641139 22:17300333-17300355 CTTGAGAGGCTGAGGTGGGAGGG + Intergenic
1180767709 22:18356062-18356084 CTTGGCAGGCTGAGGCAGGAGGG - Intergenic
1180778599 22:18506328-18506350 CTTGGCAGGCTGAGGCAGGAGGG + Intergenic
1180811324 22:18763636-18763658 CTTGGCAGGCTGAGGCAGGAGGG + Intergenic
1180824007 22:18850811-18850833 CTTGGCAGGCTGAGGCAGGAAGG + Intronic
1180990753 22:19934271-19934293 CTAGGGAGGCTGAGGCTGGAGGG + Intronic
1181101188 22:20540464-20540486 ATCGACAGGCTGAGGCTGGAGGG + Intronic
1181124434 22:20693964-20693986 CTTGGCAGGCTGAGGCAGGAGGG + Intergenic
1181145517 22:20843245-20843267 TTTGGAAGGCTGAGGCAGGAGGG + Intronic
1181188730 22:21123737-21123759 CTTGGCAGGCTGAGGCAGGAAGG - Intergenic
1181197476 22:21197891-21197913 CTTGGCAGGCTGAGGCAGGAGGG + Intergenic
1181210468 22:21286756-21286778 CTTGGCAGGCTGAGGCAGGAAGG + Intergenic
1181299821 22:21871717-21871739 CTTGGGAGGCTGAGGCGGGAAGG + Intergenic
1181312740 22:21954121-21954143 CTAGGAAGGCTGAGGCAGGAGGG - Intergenic
1181399041 22:22640135-22640157 CTTGGCAGGCTGAGGCAGGAAGG - Intergenic
1181501771 22:23319481-23319503 CTTGGCAGGCTGAGGCAGGAAGG - Intergenic
1181544840 22:23596365-23596387 CTTGCGAAGCTGAGGTGGGAGGG - Intergenic
1181634444 22:24168069-24168091 CCTCACAAGCTGAGGCTGGCAGG - Intronic
1181650380 22:24255924-24255946 CTTGGCAGGCTGAGGCAGGAAGG + Intergenic
1181707000 22:24654814-24654836 CTTGGCAGGCTGAGGCAGGAAGG - Intergenic
1181772159 22:25133648-25133670 CTCGGGAAGCTGAGGCAGGAGGG - Intronic
1181815467 22:25433503-25433525 CTTGCGAAGCTGAGGTGGGAGGG + Intergenic
1182032099 22:27167490-27167512 CTTGAACCCCTGTGGCTGGATGG - Intergenic
1182098263 22:27640195-27640217 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1182140164 22:27947935-27947957 CTTGAAAGGCTGACGAAGGAGGG + Intergenic
1182207444 22:28643212-28643234 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1182476448 22:30579141-30579163 CTGGAAGAGCAGAGGATGGAGGG - Exonic
1182480849 22:30607777-30607799 TTTGGAAGGCTGAGGCGGGAGGG + Intronic
1182596021 22:31421219-31421241 CTTAGAAGGCTGAGGCAGGAGGG - Intronic
1182655761 22:31888655-31888677 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1182884664 22:33763073-33763095 CTGGAAATGCTAAGGCTGGTGGG - Intronic
1183295264 22:37025442-37025464 CTTGGAGAACTGAGGGTGGAAGG + Intronic
1183478135 22:38047328-38047350 CTTGGAAGGCTGAGGTAGGAGGG + Intergenic
1183554016 22:38511024-38511046 CTTGGGAGGCTGAGGCGGGAGGG + Intergenic
1183572877 22:38667414-38667436 CTTGGGAAGCTGAGGCTGGGGGG - Intronic
1184303844 22:43580916-43580938 CCTGAAGACCTGAGGCTTGAAGG + Intronic
1184307563 22:43616769-43616791 CAGTAAAGGCTGAGGCTGGAGGG + Intronic
1184342825 22:43895487-43895509 CTTGAAAGGCTGAGGCGGGAGGG + Intergenic
1184462933 22:44649562-44649584 CTTGAGAGGCTGAGGTGGGAGGG + Intergenic
1184509327 22:44923901-44923923 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1184969588 22:48006231-48006253 TTTGAAAGGCTGAGGCAGGGTGG - Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185169747 22:49285892-49285914 CTTTACATCCTGAGGCTGGAAGG + Intergenic
1185265160 22:49898106-49898128 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1203216478 22_KI270731v1_random:8674-8696 CTTGGCAGGCTGAGGCAGGAAGG - Intergenic
1203229324 22_KI270731v1_random:96945-96967 CTTGGCAGGCTGAGGCAGGAGGG - Intergenic
1203274148 22_KI270734v1_random:76714-76736 CTTGGCAGGCTGAGGCAGGAAGG + Intergenic
949477773 3:4465365-4465387 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
949541882 3:5038919-5038941 CTTGTGAGGCTGAGGCAGGAAGG + Intergenic
949706726 3:6826934-6826956 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
949769554 3:7564558-7564580 CTGGAAAAGTTGAAGCTCGAGGG + Intronic
949861532 3:8509710-8509732 CTGGAAAATCTGAGGGTGGTTGG - Intronic
950010829 3:9722620-9722642 CTTGGAAGGCTGAGGTGGGAGGG - Intronic
950057061 3:10033803-10033825 CTTGGGAAGCTGAGGCAGAATGG - Intronic
950150573 3:10683902-10683924 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
950169632 3:10829328-10829350 CCTGTAGAGATGAGGCTGGAAGG - Intronic
950350513 3:12346740-12346762 CTTGAGAGGCTGAGGCAGGAGGG - Intronic
951140785 3:19156095-19156117 CGTGAAAATAAGAGGCTGGAAGG - Intronic
952278281 3:31899049-31899071 CTTGATAGGCTGAGGCAGGGAGG - Intronic
952500153 3:33954110-33954132 TTATAAAAGCTAAGGCTGGAGGG - Intergenic
952723246 3:36555361-36555383 CTTGGAAGGCTGAGGCAGGAGGG + Intergenic
952777641 3:37061496-37061518 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
953006256 3:38982090-38982112 CTGGAACACCTGAGGCTGGATGG - Intergenic
953137535 3:40195398-40195420 CTTGGGAAGCTGAGGCTGGAGGG - Intronic
953146689 3:40283074-40283096 CTTGGGAAGCTGAGGCAGAATGG - Intergenic
953163276 3:40441916-40441938 CTTGGAAGGCTGAGGCAGGAGGG + Intergenic
953289671 3:41649018-41649040 CTTGGGAAGCTGAGGCAGGCGGG + Intronic
953558174 3:43963279-43963301 CTTGGGAAGCTGAGGTGGGAGGG + Intergenic
953861772 3:46550497-46550519 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
954015151 3:47682497-47682519 TTTGAGAGGCTGAGGCTGGTGGG - Intronic
954311013 3:49767166-49767188 CTTGGAAGGCTGAGGCAGGCAGG + Intronic
954523124 3:51247671-51247693 CGTAAAAATCTGAGGCTGCAAGG + Intronic
955526860 3:59829966-59829988 CTTGGGAGGCTGAGGTTGGAGGG + Intronic
955820025 3:62887012-62887034 CTTGGAAGGCTGAGGTGGGAGGG - Intergenic
956089373 3:65649272-65649294 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
956163061 3:66374771-66374793 CTTGGGAAGCTGAGGTGGGAGGG + Intronic
956665058 3:71634179-71634201 CTTGGGAGGCTGAGGCAGGACGG - Intergenic
956800905 3:72757495-72757517 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
957333233 3:78793012-78793034 CTTGGCAGGCTGAGGCAGGAGGG + Intronic
957790077 3:84929434-84929456 CCTGAAAAGCTGTGGGAGGATGG + Intergenic
959037243 3:101382282-101382304 CTAAGAAAGCTGAAGCTGGAAGG - Intronic
959058272 3:101590650-101590672 CTTGAGAGGCTGAGGTGGGAGGG - Intronic
959075331 3:101743501-101743523 CTTGGAAGGCTGAGACAGGACGG - Intronic
959651960 3:108758740-108758762 TTTGATAGGCTGAGGCAGGAGGG + Intergenic
960891507 3:122453054-122453076 CTTGAGAGGCTGAGGTGGGAGGG - Intronic
961148331 3:124614374-124614396 CTTGAGAGGCTGAGGTGGGAGGG - Intronic
961471837 3:127119730-127119752 CTTGAAAAGCTGTGGTAGTAGGG + Intergenic
961604883 3:128086237-128086259 TTTGGGAGGCTGAGGCTGGAGGG - Intronic
961902936 3:130231990-130232012 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
962224341 3:133593078-133593100 CTTGAGAGGCTGAGGCGGGGAGG - Intergenic
962522310 3:136208824-136208846 CTTGAGAGGCTGAGGCAGGGAGG - Intergenic
962893377 3:139692467-139692489 ATGGGAAAGGTGAGGCTGGAGGG + Intergenic
963136623 3:141911600-141911622 CTTGGAAGGCTGAGGCATGAGGG - Intronic
963139461 3:141935603-141935625 CTTGGGAAGCTAAGGCAGGAGGG + Intergenic
963517404 3:146325889-146325911 CTTGGGAGGCTGAGGCTGAATGG - Intergenic
964019361 3:151989629-151989651 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
964353375 3:155825255-155825277 CTTGGGAAGCTTAGGCGGGAGGG - Exonic
965403728 3:168245675-168245697 ACTGAAAAGCTTTGGCTGGAAGG + Intergenic
965825752 3:172727861-172727883 TTTGGGAAGCTGAGGCGGGAGGG - Intergenic
965835727 3:172849997-172850019 ATTTAAAAGCCCAGGCTGGATGG - Intergenic
966399850 3:179537099-179537121 GTTGAAATGGTGAGCCTGGAAGG - Intergenic
966740790 3:183231560-183231582 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
966883174 3:184361267-184361289 CTTGGAAGTCTGAGGCTGCAGGG - Intronic
967208205 3:187143000-187143022 CTTGGGAGGCTGAGGCGGGAGGG + Intronic
967265942 3:187692411-187692433 CTTGAGAGGCTGAGGTGGGAAGG - Intergenic
967993193 3:195146945-195146967 CTTGGAAGGCTGAGGCAGGGGGG - Intronic
968129818 3:196186505-196186527 CCTGAAAATCTGAGGCCGGATGG + Intergenic
968234494 3:197023684-197023706 CTGGAAAAGCTCAGTCTGGCTGG - Intronic
968837837 4:2978700-2978722 TTTGAGAGGCTGAGGCAGGAGGG + Intronic
968936532 4:3614039-3614061 CTGGAGAAGCTGAGGATGGGAGG - Intergenic
969386323 4:6851463-6851485 TTTGAGAAGCTGAGGCGGGTGGG + Intronic
970392952 4:15634294-15634316 CTTGAGAGGCTGAGGTGGGAGGG - Intronic
970612635 4:17739796-17739818 CTTGCAAGGCTGAGGCAGGTGGG - Intronic
971114904 4:23633663-23633685 CTTGGGAAGCTGAGGCAGGAGGG + Intergenic
971447547 4:26767060-26767082 TTTGAGAGGCTGAGGCAGGAGGG + Intergenic
971594363 4:28509851-28509873 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
971713464 4:30146705-30146727 TTTGAGAAGCTGAGGCAGGAGGG + Intergenic
972032991 4:34486081-34486103 CTTGGGAAGCAGAGGCAGGAGGG - Intergenic
972258897 4:37388289-37388311 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
972389207 4:38597282-38597304 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
972405382 4:38741559-38741581 CTTAGAAGGCTGAGGCAGGAGGG - Intergenic
973303059 4:48611641-48611663 CTTGAAAAGGTGACTCTAGATGG - Intronic
973318768 4:48788600-48788622 CTCGGAAGGCTGAGGCAGGAGGG - Intergenic
973325019 4:48851443-48851465 TTTGGGAAGCTGAGGCAGGAGGG + Intronic
973700740 4:53534394-53534416 TTTGGAAGGCTGAGGCAGGAGGG + Intronic
973903427 4:55501523-55501545 CTTGGGAGGCTGAGGCGGGAGGG - Intronic
973991919 4:56417676-56417698 CTTGTGAGGCTGAGGCAGGAAGG + Intronic
974083372 4:57235057-57235079 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
974172024 4:58278750-58278772 CTTGAAAAACTGGATCTGGAAGG + Intergenic
974310092 4:60194682-60194704 CTTGGGAAGCTGAGGCAGGAGGG - Intergenic
974423707 4:61712283-61712305 CTTGAGAGGCTGAGGCAGGAGGG + Intronic
974883607 4:67788866-67788888 TTTGAAAGGCTGAAGTTGGAGGG - Intergenic
975713247 4:77181262-77181284 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
975795591 4:78003370-78003392 CTTCAGAGGCTGAGGCAGGAGGG - Intergenic
975979470 4:80140275-80140297 CTTTAAAAGCTGAGTTTGGAAGG - Intergenic
976704948 4:88010200-88010222 CTTGGGAAGCTGAGGTGGGAGGG - Intronic
977277884 4:95001024-95001046 CTTGAAAAGCTGATGTTTGGCGG - Intronic
977565507 4:98576606-98576628 CTTGGAAAACTGAGGATGGAGGG + Intronic
977773520 4:100889302-100889324 CTGAAAATCCTGAGGCTGGAAGG + Intergenic
978937417 4:114395010-114395032 CTGGAGAAGCTGTGTCTGGATGG - Intergenic
979028891 4:115613856-115613878 CTCCAGAAGCTGAGGTTGGAAGG + Intergenic
979463752 4:121012748-121012770 CTTGGGAAGCTGAGGTGGGAGGG - Intergenic
979666430 4:123316020-123316042 TTTGGGAAGCTGAGGCAGGAGGG - Exonic
980040328 4:127932001-127932023 CTTAGAGGGCTGAGGCTGGAAGG + Intronic
980053160 4:128057856-128057878 CTTGGGAGGCTGAGGCTGGCAGG + Intergenic
980480873 4:133385490-133385512 CTTGCAAGGCTGCAGCTGGAGGG - Intergenic
980854204 4:138419739-138419761 TTTGGGAGGCTGAGGCTGGAGGG - Intergenic
980873874 4:138641034-138641056 CTTGAAGAGAAGGGGCTGGAAGG - Intergenic
981080723 4:140636631-140636653 CTTGGGAAGCTGAGGTGGGAGGG - Intronic
981302499 4:143204495-143204517 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
981535385 4:145794577-145794599 CTCAGAAAGCTGAGGCTGGGCGG + Intronic
982235008 4:153243924-153243946 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
982710466 4:158753561-158753583 CTTGGGAAGCTGAGGCAGGAGGG + Intergenic
982726295 4:158910121-158910143 TTTGGGAAGCTGAGGCAGGAGGG - Intronic
983359064 4:166705310-166705332 TTTGGGAAGCTGAGGCAGGAGGG - Intergenic
983517835 4:168675946-168675968 CTTGGAAGGCTGAGGTGGGAGGG + Intronic
983627348 4:169815204-169815226 CTTGAGAGGCTGAGGTGGGAGGG - Intergenic
983682719 4:170372105-170372127 CTTGAGAGGCTGAGGCAGGAGGG - Intergenic
984251951 4:177346272-177346294 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
984445274 4:179828820-179828842 CTTTAAAAGAAAAGGCTGGAAGG - Intergenic
984553886 4:181191663-181191685 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
984955546 4:185042149-185042171 TTTGGAAGGCTGAGGCAGGAGGG + Intergenic
984970818 4:185188261-185188283 CTTTGAAGGCTGAGGCTAGAGGG - Intronic
985976680 5:3424443-3424465 TTTGAGAGGCTGAGGCAGGAGGG + Intergenic
986392176 5:7297431-7297453 CTTGAGAGGCTGAGGCAAGAAGG - Intergenic
986405359 5:7419916-7419938 CTTGGAAAGCTGGGGTAGGATGG - Intronic
986545096 5:8888325-8888347 TTTGAAAAGATGAGTCTGCAAGG - Intergenic
986831199 5:11580628-11580650 CTGGAAAGGCTGACGCTTGAAGG - Intronic
987071294 5:14339127-14339149 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
987710316 5:21495860-21495882 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
988659284 5:33246923-33246945 CTTGAGAGGCTGAGGTGGGAGGG - Intergenic
989074952 5:37554812-37554834 CTCGAGAGGCTGAGGCAGGAGGG - Intronic
989288758 5:39736618-39736640 CTTGAGATGCTGAGGTGGGATGG - Intergenic
990212298 5:53493671-53493693 CTTGGGAGGCTGAGGTTGGAGGG + Intergenic
990635984 5:57726764-57726786 CTCGGAAAACTGAGGCAGGAGGG - Intergenic
991017804 5:61950073-61950095 TTTGGAAGGCTGAGGCAGGAAGG + Intergenic
991249537 5:64544564-64544586 CCTGGGAAGCTGAGGCAGGAGGG + Intronic
991250266 5:64552817-64552839 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
991279923 5:64901351-64901373 CTTGGGAAGCTGAGGCAGAATGG + Intronic
991396839 5:66213050-66213072 CTTGGCAGGCTGAGGCAGGAGGG - Intergenic
991441842 5:66658912-66658934 CTTGAGAGGCAGAGGCAGGAGGG + Intronic
991737550 5:69641509-69641531 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991760644 5:69914916-69914938 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
991786688 5:70203185-70203207 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991789126 5:70221235-70221257 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991813876 5:70496341-70496363 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991817007 5:70517625-70517647 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991839875 5:70789966-70789988 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
991879133 5:71203570-71203592 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991881573 5:71221599-71221621 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991907854 5:71530142-71530164 CTTGAAGAGTTGGGACTGGATGG - Intronic
991968774 5:72118251-72118273 CTTGGAAGGCTGAGGTGGGAGGG - Intronic
992060894 5:73046171-73046193 CTTGGAAGGCTCAGGCAGGAAGG - Intronic
992598153 5:78366876-78366898 CTTGGGAGGCTGAGGCGGGAGGG + Intronic
992756213 5:79908911-79908933 CTTGAGAGGCTGAGGTGGGAGGG - Intergenic
992911933 5:81403756-81403778 CTTGAAAAGGTGAGGCTTGTTGG - Intergenic
993300301 5:86200725-86200747 TTTGAGAGGCTGAGGCTGGCTGG - Intergenic
993528683 5:88999283-88999305 CTTGAGAGGCTGAGGTCGGAGGG - Intergenic
994362464 5:98868217-98868239 CTCGAGAGGCTGAGGCAGGAGGG + Intronic
994402648 5:99300875-99300897 CTTCAAAGGCTGAGGCTGGGAGG - Intergenic
994422269 5:99535961-99535983 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
994899785 5:105757077-105757099 CCTGGAAGGCTGAGGCAGGATGG + Intergenic
995506548 5:112866452-112866474 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
995561943 5:113391608-113391630 CTTGGAAGGCTAAGGCAGGAAGG + Intronic
995655957 5:114426072-114426094 CTTGGGGAGCTGAGGCAGGAGGG + Intronic
996212012 5:120822451-120822473 CTTGGGAAGCTGAGGTGGGAGGG - Intergenic
996568707 5:124909429-124909451 CTTCAAAGGCAGAGCCTGGATGG + Intergenic
996572937 5:124952111-124952133 CCTGGAAAGCTGAGGCTGCGGGG - Intergenic
997003434 5:129789491-129789513 CTCAAAAAACTGAGGATGGAAGG + Intergenic
997369667 5:133350440-133350462 CCTGAGAGCCTGAGGCTGGAGGG - Intronic
997482806 5:134201167-134201189 TTTGGGAAGCTGAGGCAGGAGGG + Intronic
997491369 5:134279573-134279595 TTTGGAAAGCTGAGGTGGGAGGG + Intergenic
997704429 5:135933749-135933771 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
998008365 5:138672719-138672741 CTTGGAAGGCTGAGCCTGGGAGG + Intronic
998245544 5:140500348-140500370 GTTGAAAAACTGAAGCTGGCCGG + Intronic
998947191 5:147352506-147352528 CTTGCATTGTTGAGGCTGGACGG - Intronic
999324432 5:150634711-150634733 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
999721133 5:154400028-154400050 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
999799920 5:155023913-155023935 CTTGGGAAGCTGAGGTGGGAGGG - Intergenic
1000047143 5:157531104-157531126 GATGAAAAGCTGAGGCTCAAAGG + Intronic
1000080357 5:157839495-157839517 CTTGAGAGGCTGAGGCAGAATGG + Intronic
1000355460 5:160390170-160390192 TTTGGGAAGCTGAGGCAGGAGGG - Intergenic
1000357823 5:160417902-160417924 GTTGTAATGGTGAGGCTGGAAGG - Intronic
1001800333 5:174538036-174538058 CTTGAGAGGCTGAGGTGGGAGGG - Intergenic
1002118106 5:176980846-176980868 CTTGGGAAGCTGAGGCAGGTGGG - Intronic
1003481741 6:6540616-6540638 CTTGGGAGGCTGAGGCTGGAGGG - Intergenic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1003553616 6:7120929-7120951 CTCGAGAGGCTGAGGCAGGAGGG - Intronic
1003557965 6:7157661-7157683 TTTGAGAAGCTGAGGTCGGAGGG + Intronic
1004226675 6:13791145-13791167 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1004500744 6:16207828-16207850 TTTGAGAGGCTGAGGCTGGTGGG + Intergenic
1004707524 6:18138372-18138394 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1004716148 6:18218226-18218248 CTTGGGAAGCTGAGGTGGGAGGG - Intronic
1004904355 6:20222616-20222638 CTTGCAAAGCTGAGGCTGGAGGG + Intergenic
1004957701 6:20748400-20748422 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1005121310 6:22392141-22392163 CTTTAAAACATAAGGCTGGAAGG + Intergenic
1005547374 6:26884650-26884672 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
1005801597 6:29430656-29430678 CTTGGAAAGGTGAGGTGGGAAGG + Intronic
1005991296 6:30904248-30904270 CTTGAGAGGCTGAGGCAGGAGGG - Intergenic
1006076167 6:31534115-31534137 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
1006601241 6:35227694-35227716 ACTGCAAAGGTGAGGCTGGAAGG + Exonic
1006713899 6:36101328-36101350 CTTGGGAAGCTGAGGCAGGAGGG + Intronic
1006718906 6:36137544-36137566 CTTGAGAGGCTGAGGTGGGAGGG + Intronic
1006845733 6:37060072-37060094 CTTGAGAGGCTGAGGTGGGAGGG - Intergenic
1007773777 6:44212138-44212160 TTTGAGAGGCTGAGGCGGGAGGG + Intergenic
1007798503 6:44371189-44371211 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1007817124 6:44532426-44532448 GTGGCAGAGCTGAGGCTGGATGG + Intergenic
1008402562 6:51080343-51080365 TTTGAGAAGCTGAGGTGGGAGGG + Intergenic
1008749563 6:54716055-54716077 CAAGAAAAGCTGAAACTGGAAGG - Intergenic
1009018134 6:57925722-57925744 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
1009327868 6:62376148-62376170 CTTGAAAAGCAGTCCCTGGATGG + Intergenic
1009372495 6:62924357-62924379 CTGGAAAATCTGTGGCTAGATGG - Intergenic
1009562368 6:65263791-65263813 CTTGATAGGCAGAGGCAGGACGG + Intronic
1009937963 6:70256002-70256024 GTTGAAAAGATGAGATTGGAAGG - Intronic
1010213655 6:73382942-73382964 CTTGGAAGGCTGAGCCTGGGAGG - Intronic
1010694067 6:78948600-78948622 CTTGAGAGGCTGAGGTGGGAAGG - Intronic
1010729610 6:79376209-79376231 ATTGAAAAGCTGAGTCTGTGTGG + Intergenic
1010767651 6:79794710-79794732 CCTGGAAAACTGAGGCAGGAAGG + Intergenic
1010907766 6:81513735-81513757 GTTAAAAAGCTGAGGCTGACAGG + Intronic
1010977772 6:82335740-82335762 GTTGAAAAGATAAGGCTGTAAGG + Intergenic
1011041721 6:83036839-83036861 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1013085482 6:106853393-106853415 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1013136007 6:107283216-107283238 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1013434314 6:110086810-110086832 GTTGGAAGGCTGAGGCTGGAGGG - Intergenic
1013504738 6:110788268-110788290 TTTGAGAAGCTGAGGCAGGAGGG - Intronic
1013510014 6:110835935-110835957 CCAGAAAGGCTGAGGCTGCAGGG + Intronic
1013530217 6:111012412-111012434 TTTGGGAGGCTGAGGCTGGAGGG - Intronic
1013579443 6:111518549-111518571 CTAGAAAATCTGGGGCTAGATGG - Intergenic
1013582090 6:111545559-111545581 TTTGGAAGGCTGAGGCAGGAGGG + Intergenic
1014030120 6:116691359-116691381 CTTGAGAAGCTGAGGTGGGAGGG - Intronic
1014048370 6:116921713-116921735 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1014102243 6:117524307-117524329 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1014143852 6:117973667-117973689 CTGGGAAGGCTGAGGCAGGAGGG - Intronic
1014889340 6:126823660-126823682 CTTGGGACGCTGAGGCAGGAAGG - Intergenic
1014930127 6:127325806-127325828 CTTGGGAGGCTGAGGCGGGAAGG - Intronic
1015157901 6:130117805-130117827 CTTGGGAAGCTGAGGCAGGTGGG - Intronic
1015912173 6:138179915-138179937 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1015964048 6:138680722-138680744 ATTGGGAGGCTGAGGCTGGAGGG - Intronic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016318764 6:142819124-142819146 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1016846555 6:148573595-148573617 CTTGAGAAGCTGTGGCAGGAGGG + Intergenic
1017148389 6:151255553-151255575 TTTGAGAAGCCGAGGCAGGAGGG + Intronic
1017159036 6:151348394-151348416 TTTGAGAAGCTGAGACAGGAGGG + Intronic
1017208807 6:151832794-151832816 CTTGAAAAGCTTAGTTGGGAAGG + Intronic
1017495514 6:154979725-154979747 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1018131900 6:160739651-160739673 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1018396061 6:163378869-163378891 CTTGAGAGGCTGAGGCTGGGAGG + Intergenic
1018457893 6:163969161-163969183 CTTGGGAAGCTGAGGTGGGAGGG + Intergenic
1019230782 6:170560395-170560417 CTTGGGAGGCTGAGGCGGGAGGG + Intronic
1019337018 7:490222-490244 CTCAGAAGGCTGAGGCTGGAAGG + Intergenic
1019364656 7:627230-627252 TTTGAGAGGCTGAGGCGGGATGG - Intronic
1019566607 7:1684040-1684062 CTTGAGAGGCTGAGGAGGGAGGG + Intergenic
1019672787 7:2291190-2291212 CTTCCAAAGCTGAGGCAGGAGGG + Intronic
1019697500 7:2454134-2454156 CTTGAAAAGCTGAGACAGGAGGG + Intergenic
1020093993 7:5357588-5357610 CCAGAAAAGCTGAGGCGGGAGGG - Intronic
1020237651 7:6368792-6368814 GTTGAAAAGCTGGGACTGGGTGG - Intergenic
1020416782 7:7955445-7955467 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1020512338 7:9073411-9073433 TTGGAGAAGCTGAGGCAGGAGGG - Intergenic
1021083218 7:16388089-16388111 CTTGGGAGGCTGAGGCTGGCAGG - Intronic
1021561288 7:21971277-21971299 CTCGAGAAGCTGAGGTGGGAGGG - Intergenic
1021568478 7:22038717-22038739 CCTGAAAAGCAGAAGCTGCAGGG - Intergenic
1022241406 7:28516104-28516126 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1022286187 7:28957556-28957578 CTAGTCAAGCTGCGGCTGGACGG - Exonic
1023133624 7:37028688-37028710 CTTGGGAGGCTGAGGCGGGACGG - Intronic
1023250375 7:38253888-38253910 CTCGAGAGGCTGAGGCAGGAGGG + Intergenic
1023251680 7:38269992-38270014 CTCGAGAAGCTGAGGCAGGAGGG + Intergenic
1023612232 7:41982592-41982614 CTTGTGAGGCTGAGGCAGGAGGG + Intronic
1023963033 7:44943644-44943666 TTTCCAAGGCTGAGGCTGGAAGG + Intergenic
1024056555 7:45663226-45663248 CATCAAACGCTGAGGCTGGCAGG - Intronic
1024108606 7:46120476-46120498 TTTGAAGGGCTGAGGTTGGAGGG + Intergenic
1024560494 7:50640895-50640917 CCGGCAAAGCTGAGGATGGAAGG - Intronic
1024991936 7:55241740-55241762 CTGGAAAAGCTGAGCCATGAGGG - Intronic
1025321413 7:58098059-58098081 CTTGGGAGGCTGAGGCTGCAGGG - Intergenic
1025825548 7:65007726-65007748 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1025898554 7:65725538-65725560 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1026063437 7:67047286-67047308 CTTGGGTAGCTGAGGCGGGAGGG + Intronic
1026162099 7:67878541-67878563 CTTGGGAGGCTGAGGCTGGCGGG + Intergenic
1026164655 7:67899286-67899308 TTTGGGAGGCTGAGGCTGGAGGG - Intergenic
1026232863 7:68500400-68500422 TTTGAGAGGCTGAGGCAGGAGGG + Intergenic
1026312232 7:69196443-69196465 TTTGAATAGTGGAGGCTGGAGGG - Intergenic
1026399819 7:69998287-69998309 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1026489000 7:70846509-70846531 ATTGGAAGGCGGAGGCTGGATGG - Intergenic
1026489257 7:70848629-70848651 ATTGGAAGGCGGAGGCTGGATGG - Intergenic
1026780056 7:73260257-73260279 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1027020911 7:74813675-74813697 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1027067114 7:75132249-75132271 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1027765295 7:82332889-82332911 CTTGGAAGGCTGAGGTGGGAGGG + Intronic
1027838546 7:83278387-83278409 CATGAAAACCTGAACCTGGAAGG + Intergenic
1028159743 7:87472316-87472338 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1028406125 7:90475849-90475871 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1028450724 7:90979409-90979431 CTAGAAAAGTTGAAGCTGGTTGG - Intronic
1028595400 7:92543131-92543153 CTCAAAAGGCTGAGGCAGGAGGG + Intergenic
1029128387 7:98311434-98311456 CTTGGAAGGCTGAGGCAGAATGG + Intronic
1029303921 7:99604883-99604905 CTCAAAAGGCTGAGGTTGGAGGG + Intronic
1029626781 7:101724788-101724810 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1029923200 7:104287851-104287873 TTTGGAAGGCTGAGGCTGGAGGG - Intergenic
1030163179 7:106529011-106529033 CCTGAGAAACTGAGGCAGGAAGG + Intergenic
1030236620 7:107270367-107270389 CTTGGGAAGCTGAGGCAGGAAGG - Intronic
1030287141 7:107838291-107838313 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1030951239 7:115792660-115792682 CTTGAGAGGCTGAGGCCAGAAGG + Intergenic
1031054026 7:116974397-116974419 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1031563621 7:123267447-123267469 CTTGGGAGGCTGAGGCGGGAGGG - Intergenic
1031881015 7:127198780-127198802 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
1031962223 7:128000473-128000495 CTTGAGAGGCTGAGGTGGGAGGG - Intronic
1032081642 7:128861762-128861784 CTCGAGAAGCTGAGGCAGCAGGG - Intergenic
1032203414 7:129840292-129840314 CTTGGAAGACTGAGGCTGGGAGG - Intronic
1032229198 7:130059730-130059752 CAGGAAACCCTGAGGCTGGATGG - Intergenic
1032458988 7:132095401-132095423 ATTCAGAAGCAGAGGCTGGAAGG - Intergenic
1032811715 7:135426104-135426126 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1033052061 7:138014611-138014633 CTTGGGAAGCTGAAGCAGGAGGG - Intronic
1033146464 7:138874759-138874781 TTTGATAGGCTGAGGCGGGAGGG + Intronic
1033351242 7:140563868-140563890 CTTGGGAAGATGAGGCGGGAAGG + Intronic
1033452524 7:141474491-141474513 GTTGAAAAGCTAAGGCTTGGAGG - Exonic
1033455437 7:141498984-141499006 CTTAAAAAGCAGAGGGTGGTTGG + Intergenic
1033737413 7:144236520-144236542 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1033745643 7:144314427-144314449 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1033993620 7:147318332-147318354 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1034163497 7:149009036-149009058 CTTGGGAGGCTGAGGCAGGAAGG - Intronic
1034243306 7:149625659-149625681 CTTAAGAGGCTGAGGATGGAGGG + Intergenic
1034295196 7:149966233-149966255 CTGGAGAAACAGAGGCTGGAAGG + Intergenic
1034810867 7:154130714-154130736 CTGGAGAAACAGAGGCTGGAAGG - Intronic
1034856136 7:154549017-154549039 CTTGAAAAGTTGTGGCTGGAAGG + Intronic
1035338525 7:158145506-158145528 CTTGAGAAACTGAGGCTCCATGG + Intronic
1035946511 8:3969280-3969302 CTGCAAAAGATGAGGCTGGGTGG + Intronic
1036744798 8:11399080-11399102 CTAAAAAACCTGAGGCTGGCCGG - Intronic
1036942953 8:13068937-13068959 CTTGGAAGGCTGAGGTGGGAGGG - Intergenic
1037046552 8:14312509-14312531 CTTGGAAAGCTGAGTCAGGAGGG + Intronic
1037314924 8:17591804-17591826 CTCGGAAGGCTGAGGCAGGAGGG + Intronic
1037781959 8:21875615-21875637 TTTGAGAAGCTGAGGTGGGAGGG - Intergenic
1038150271 8:24937219-24937241 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1038163229 8:25060482-25060504 TTTGAGAGGCTGAGGCAGGACGG - Intergenic
1038417983 8:27411540-27411562 CTTAACATGATGAGGCTGGAGGG + Intronic
1038599602 8:28926673-28926695 CTTAGGAAGCTGAGGCAGGAGGG - Intronic
1039047934 8:33466995-33467017 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
1039217566 8:35289874-35289896 CTTGGAAGGCTGAGACAGGAGGG + Intronic
1039567049 8:38559310-38559332 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1039821779 8:41141398-41141420 TTTGAGAGGCTGAGGCAGGAGGG - Intergenic
1040139350 8:43892811-43892833 CTTCATAAGCTGAGGCTGTATGG + Intergenic
1040360607 8:46660790-46660812 TTTGGGAAGCTGAGGCTGGATGG - Intergenic
1040655868 8:49506772-49506794 TTTGGGAGGCTGAGGCTGGAGGG - Intergenic
1041152308 8:54948063-54948085 TTTGGGAAGCTGAGGCGGGACGG + Intergenic
1041502043 8:58549673-58549695 CTAGAGAGGCTGAGGCAGGAGGG - Intergenic
1041675077 8:60530251-60530273 CTTGAGAGGCTGAGGCAGAACGG - Intronic
1041770291 8:61465767-61465789 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1041841552 8:62278154-62278176 CTAGAAAAGCTGCTGCAGGATGG + Intronic
1041862610 8:62531582-62531604 CTTGAAGAGCTCAGTCTGGTTGG - Intronic
1041893814 8:62901360-62901382 CATGGGAAGCTGAGGCAGGAGGG + Intronic
1041991505 8:63998334-63998356 TTTGGGAAGCTGAGGCAGGAGGG - Intergenic
1042256827 8:66813144-66813166 CTTGGCAGGCTGAGGCAGGAGGG + Intronic
1042551485 8:69997586-69997608 TTTGGGAAGCTGAGGCAGGAGGG - Intergenic
1042659408 8:71137115-71137137 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1044537367 8:93372874-93372896 TTTGGAAGGCTGAGGCAGGAGGG - Intergenic
1044863659 8:96548003-96548025 TTTGGAAAGCTGAGGCAGGCAGG - Intronic
1044980036 8:97707508-97707530 TTTGAGAGGCTGAGGCAGGAGGG - Intronic
1045014525 8:97988516-97988538 CTCGAAAGGCTGAGGCAGGAGGG + Intronic
1045147583 8:99364538-99364560 CTTGGGAAGCTGAGGTGGGAGGG - Intronic
1045268132 8:100638060-100638082 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1045527153 8:102950804-102950826 CTTGGGAAGCTGAGGCAAGAGGG - Intronic
1045783079 8:105890566-105890588 CTCAGGAAGCTGAGGCTGGAGGG + Intergenic
1046439527 8:114239997-114240019 TTTGAGAAGCTGAGGCAGGAAGG + Intergenic
1047020635 8:120771975-120771997 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1047197872 8:122737899-122737921 TATCAAAAGCTGGGGCTGGAAGG + Intergenic
1047206792 8:122808968-122808990 TTATAAAAGCTGAAGCTGGAAGG + Intronic
1048383865 8:133892980-133893002 CTTGAGAGGCTGAGGTGGGAGGG + Intergenic
1048639850 8:136343465-136343487 CCTGGAAAGTTGAGGCTGCAAGG + Intergenic
1048973536 8:139658319-139658341 CTGGAAAAGCTGAGCAGGGAAGG + Intronic
1049783158 8:144438191-144438213 TTTAAAAAGCGGAGGCTGCACGG - Intronic
1049879115 8:145050075-145050097 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1049910169 9:258199-258221 CTTGAATAGCAGAGGCTGGAAGG + Intronic
1049967186 9:790401-790423 CTTGAATAGCTGAGTCTACAGGG + Intergenic
1050197357 9:3100718-3100740 CTTGGGAGGCTGAGGTTGGAGGG - Intergenic
1050342702 9:4656329-4656351 CTTGTGGGGCTGAGGCTGGAGGG + Intronic
1050677162 9:8069318-8069340 TTTGAGAGGCTGAGGCAGGAGGG - Intergenic
1050827983 9:9973362-9973384 CTTGGAAGGCTGAAGCCGGAGGG + Intronic
1051425228 9:16925632-16925654 CTTGAAAGGCTGAAGTGGGAGGG + Intergenic
1051782807 9:20708665-20708687 CTTGGAAGGCTGAGGATGGGCGG + Intronic
1052361930 9:27571561-27571583 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1052399921 9:27987380-27987402 CTCAAAAGGCTGAGCCTGGAGGG - Intronic
1052912098 9:33891923-33891945 CTTGGAAGGCTGAGGTGGGAGGG + Intronic
1052919499 9:33952975-33952997 CTTGGGAGGCTGAGGTTGGAGGG - Intronic
1052983897 9:34471315-34471337 CTTGAGAGGCTGAGGTGGGAGGG + Intronic
1053282943 9:36832829-36832851 CTTGAGAGGCTGAGGCAAGAGGG + Intergenic
1053305916 9:36984852-36984874 CTTGTACAGCTGAGGGTAGAGGG + Intronic
1053314686 9:37041351-37041373 CTGGAAAGGGGGAGGCTGGAGGG + Intergenic
1053327644 9:37169953-37169975 CTCAAGAGGCTGAGGCTGGAGGG + Intronic
1053491360 9:38506660-38506682 CTAGGAAGGCTGAGGCAGGAGGG + Intergenic
1053929831 9:43107347-43107369 CTCAAAAGGCTGAGGCAGGAGGG - Intergenic
1055932737 9:81576093-81576115 CTTGCAAAAGTGAGGCAGGAAGG - Intergenic
1056450745 9:86714433-86714455 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1056707730 9:88966311-88966333 CTTGGGAAGCTGAGGCAGGAGGG - Intergenic
1056856350 9:90132908-90132930 CTTGAGAAGCTGAGGATGTAGGG - Intergenic
1056954771 9:91073208-91073230 CTAGAGGAGCTGAGGCTGGGCGG - Intergenic
1057220931 9:93257394-93257416 GTAGAGAAGGTGAGGCTGGAGGG - Intronic
1057414016 9:94845477-94845499 CTTGAAAAGATCATGCTGGGTGG + Intronic
1057483516 9:95463762-95463784 CTTGGAAAGGGGAGACTGGAGGG + Intronic
1057671663 9:97095849-97095871 CTAGGAAGGCTGAGGCAGGAGGG + Intergenic
1057783397 9:98068703-98068725 CTTGGGAGGCTGAGGCAGGAAGG + Intronic
1057896091 9:98909779-98909801 TTTGGGAAGCTGAGGCAGGAGGG + Intergenic
1058457000 9:105147088-105147110 TTTGGGAAGCTGAGGCAGGAGGG + Intergenic
1058650051 9:107167229-107167251 CTTGAGAGGCTGAGGTGGGAGGG - Intergenic
1058672416 9:107371153-107371175 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1058776582 9:108290174-108290196 CTTGCAAAGCTGAAACTGTATGG - Intergenic
1058810369 9:108633270-108633292 CTTGAGAGGCTGAAGCAGGAAGG + Intergenic
1059766637 9:117389777-117389799 CTTGAAAAGTTTAGTCTGGAGGG + Intronic
1059872032 9:118588111-118588133 TATGAAAAAATGAGGCTGGATGG - Intergenic
1060360493 9:122951813-122951835 CTTGAGAGGCTGAGGTGGGAGGG - Intronic
1060395888 9:123316233-123316255 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1060400039 9:123343197-123343219 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1060539985 9:124422869-124422891 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1060680109 9:125554686-125554708 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1060743148 9:126112771-126112793 TTTGATAAAATGAGGCTGGAGGG + Intergenic
1061090890 9:128425423-128425445 CTTGGGAAGCTGAGGCTGGAGGG + Intronic
1061257197 9:129459946-129459968 ATGGAAAAACTGAGGCTGGGAGG - Intergenic
1061344768 9:130014357-130014379 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1061357855 9:130119929-130119951 CTTGAGAGGCTGAGGTAGGAGGG - Intronic
1061469019 9:130807939-130807961 TTTGAAAAGCTGAGGTGGGGGGG - Intronic
1061509602 9:131052574-131052596 CCTGTACAGCTGAGGCTGGAAGG + Exonic
1061611794 9:131751566-131751588 CTTGGGAAGCTGAGGCAGGAGGG + Intergenic
1061745817 9:132739649-132739671 CTTGGGAGGCTGAGGCAGGAGGG + Intronic
1062235873 9:135507269-135507291 CTGGCCAAGCTGGGGCTGGACGG - Intergenic
1185553369 X:1001657-1001679 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1185666319 X:1768199-1768221 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1185943065 X:4342640-4342662 CTTGGAAGGCTGAGGGTGGGAGG + Intergenic
1185967175 X:4619795-4619817 CTTGGGAAGCTGATGCAGGAGGG + Intergenic
1186027908 X:5334046-5334068 CTTGAGAGGCTGAGGTAGGAGGG + Intergenic
1186490833 X:9970700-9970722 CTTGGAAGGCTAAGGCGGGAGGG - Intergenic
1186779836 X:12901448-12901470 TTTGGGAAGCTGAGGCAGGAAGG + Intergenic
1187277736 X:17831004-17831026 GTAGAAAAGATGAGGATGGATGG - Intronic
1187477707 X:19626673-19626695 CTTGGGAGGCTGAGGCGGGAGGG - Intronic
1187683038 X:21787322-21787344 CTCGAGAGGCTGAGGCGGGAGGG - Intergenic
1187827648 X:23347900-23347922 CTTGGGAAGCTGAGACAGGAGGG + Intronic
1188541446 X:31254935-31254957 CTTGGAAGGCTGAGGTGGGAGGG + Intronic
1188946040 X:36303425-36303447 TTTGGGAAGCTGAGTCTGGAGGG - Intronic
1188968203 X:36580573-36580595 CTTGGAAGGCTGAGGCAGGCAGG + Intergenic
1189347066 X:40249888-40249910 CTTGGGAAGCTGAGGAGGGAGGG - Intergenic
1189470963 X:41313827-41313849 CTTGGGAAGCTGAGGCAGGAGGG + Intergenic
1189477371 X:41366400-41366422 CTTGGAAAGCTGAGGTGGGAGGG - Intergenic
1189820513 X:44866301-44866323 TTTGGAAGGCTGAGGCTGGTGGG - Intergenic
1190717069 X:53114004-53114026 CTTGGAAGGCTGAGGCAGGAGGG - Intergenic
1191741828 X:64444418-64444440 CTTGGGAGGCTGAGGCAGGAAGG - Intergenic
1192483649 X:71506281-71506303 CTTGAGAAGCTGAGGTGAGAGGG + Intronic
1192618739 X:72655163-72655185 TTTGAGAGGCTGAGGCAGGAGGG + Intronic
1192729714 X:73790886-73790908 ATTGAAGAGCTGAGGGTGCAGGG - Intergenic
1193123656 X:77849182-77849204 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1193667627 X:84341837-84341859 CTTGGAAAGCTGAGGCGAAAAGG - Intronic
1194413814 X:93586215-93586237 TTTGGGAGGCTGAGGCTGGAAGG - Intergenic
1195202361 X:102563979-102564001 CTCGAAGAGCTATGGCTGGAAGG + Intergenic
1195365849 X:104124644-104124666 CTTGGGGAGCTGAGGCAGGAGGG + Intronic
1195482495 X:105362250-105362272 CTTGAAAATGTGAAGGTGGATGG + Intronic
1195558384 X:106254001-106254023 CTCGAAAAACTGAGGATAGAAGG - Intergenic
1195612712 X:106887068-106887090 CTTGGGAGGCTGAGGCAGGAGGG - Intronic
1195664433 X:107416042-107416064 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1195798328 X:108678621-108678643 CTTGAGAGGCTGGGGCAGGAGGG + Intronic
1196681109 X:118470437-118470459 CTTGAGAGGCTGAGGTGGGAGGG + Intergenic
1196847756 X:119910053-119910075 CTTGGGAGGCTGAGGCGGGAGGG + Intronic
1197755665 X:129992342-129992364 CTTGGGAAGCTGAGGTGGGAGGG + Intronic
1197839083 X:130726292-130726314 CTTGTAAAGCAGAGGCTCCATGG + Intronic
1198075906 X:133192699-133192721 TTTGGGAAGCTGAGGCGGGAGGG + Intergenic
1198186326 X:134257269-134257291 CTTGGAAGGCTGAGGCAGGCAGG - Intergenic
1198771442 X:140135025-140135047 CTTGAAAAGGAGAGGATGGTGGG + Intergenic
1198789496 X:140328094-140328116 CTTGAGAGGCTGAGGAGGGAAGG + Intergenic
1198803597 X:140472104-140472126 CTTGAGAGGCTGAAGCAGGAGGG - Intergenic
1199761637 X:150908961-150908983 CTTAAGAGGCTGAGGCAGGAGGG + Intergenic
1199845887 X:151692988-151693010 CTTGTCAAGCTGAGGCTGGAGGG - Intergenic
1200180832 X:154149848-154149870 TTTGGGAGGCTGAGGCTGGAGGG - Intronic
1200186475 X:154186962-154186984 TTTGGGAGGCTGAGGCTGGAGGG - Intergenic
1200192127 X:154224100-154224122 TTTGGGAGGCTGAGGCTGGAGGG - Intronic
1200197882 X:154261904-154261926 TTTGGGAGGCTGAGGCTGGAGGG - Intronic
1200419563 Y:2950157-2950179 CTTGGGAAGCTGAGGTAGGAAGG - Intronic
1200427733 Y:3040015-3040037 CTTGGGAGGCTGAGGCAGGAGGG - Intergenic
1200799327 Y:7371504-7371526 TTTAAGAAGCTGAGGCAGGAGGG - Intergenic
1201269310 Y:12239108-12239130 CTTGGGAGGCTGAGGCAGGAGGG + Intergenic
1201727986 Y:17174576-17174598 CTTGGAAGGCTGAGGGTGGGAGG + Intergenic
1202019461 Y:20449740-20449762 AGTGAAAGGCTGAAGCTGGATGG - Intergenic