ID: 1114427501

View in Genome Browser
Species Human (GRCh38)
Location 14:22636434-22636456
Sequence CATCAGAGGGAGACCCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114427501_1114427511 13 Left 1114427501 14:22636434-22636456 CCCTCCAGGGTCTCCCTCTGATG No data
Right 1114427511 14:22636470-22636492 GGACGGTGCTGCTGCCATCTCGG No data
1114427501_1114427508 -4 Left 1114427501 14:22636434-22636456 CCCTCCAGGGTCTCCCTCTGATG No data
Right 1114427508 14:22636453-22636475 GATGCCGAGCCAAGGCTGGACGG 0: 21
1: 57
2: 62
3: 49
4: 155
1114427501_1114427507 -8 Left 1114427501 14:22636434-22636456 CCCTCCAGGGTCTCCCTCTGATG No data
Right 1114427507 14:22636449-22636471 CTCTGATGCCGAGCCAAGGCTGG 0: 36
1: 231
2: 618
3: 475
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114427501 Original CRISPR CATCAGAGGGAGACCCTGGA GGG (reversed) Intergenic
No off target data available for this crispr