ID: 1114433108

View in Genome Browser
Species Human (GRCh38)
Location 14:22679285-22679307
Sequence GGTACTTATCTCAACACAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114433108_1114433116 -6 Left 1114433108 14:22679285-22679307 CCCCCTGTGTTGAGATAAGTACC No data
Right 1114433116 14:22679302-22679324 AGTACCTGGTGGGAGGTGATTGG No data
1114433108_1114433119 2 Left 1114433108 14:22679285-22679307 CCCCCTGTGTTGAGATAAGTACC No data
Right 1114433119 14:22679310-22679332 GTGGGAGGTGATTGGATCATGGG 0: 1894
1: 4468
2: 9014
3: 11526
4: 10061
1114433108_1114433120 8 Left 1114433108 14:22679285-22679307 CCCCCTGTGTTGAGATAAGTACC No data
Right 1114433120 14:22679316-22679338 GGTGATTGGATCATGGGTTGTGG No data
1114433108_1114433118 1 Left 1114433108 14:22679285-22679307 CCCCCTGTGTTGAGATAAGTACC No data
Right 1114433118 14:22679309-22679331 GGTGGGAGGTGATTGGATCATGG 0: 1936
1: 4532
2: 7496
3: 10022
4: 10633

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114433108 Original CRISPR GGTACTTATCTCAACACAGG GGG (reversed) Intergenic
No off target data available for this crispr