ID: 1114436648

View in Genome Browser
Species Human (GRCh38)
Location 14:22712454-22712476
Sequence CTGGATATTAACATCACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114436648_1114436658 16 Left 1114436648 14:22712454-22712476 CCTCCTGTGATGTTAATATCCAG No data
Right 1114436658 14:22712493-22712515 ATTACTCCCAGTAATGCAAGGGG No data
1114436648_1114436656 14 Left 1114436648 14:22712454-22712476 CCTCCTGTGATGTTAATATCCAG No data
Right 1114436656 14:22712491-22712513 ATATTACTCCCAGTAATGCAAGG No data
1114436648_1114436657 15 Left 1114436648 14:22712454-22712476 CCTCCTGTGATGTTAATATCCAG No data
Right 1114436657 14:22712492-22712514 TATTACTCCCAGTAATGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114436648 Original CRISPR CTGGATATTAACATCACAGG AGG (reversed) Intergenic
No off target data available for this crispr