ID: 1114438054

View in Genome Browser
Species Human (GRCh38)
Location 14:22724536-22724558
Sequence AACTATAAGCTATTTATAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114438050_1114438054 12 Left 1114438050 14:22724501-22724523 CCTGGCCCTAGAATGAAATTTTT No data
Right 1114438054 14:22724536-22724558 AACTATAAGCTATTTATAGGAGG No data
1114438052_1114438054 6 Left 1114438052 14:22724507-22724529 CCTAGAATGAAATTTTTAACTCA No data
Right 1114438054 14:22724536-22724558 AACTATAAGCTATTTATAGGAGG No data
1114438049_1114438054 15 Left 1114438049 14:22724498-22724520 CCTCCTGGCCCTAGAATGAAATT No data
Right 1114438054 14:22724536-22724558 AACTATAAGCTATTTATAGGAGG No data
1114438051_1114438054 7 Left 1114438051 14:22724506-22724528 CCCTAGAATGAAATTTTTAACTC No data
Right 1114438054 14:22724536-22724558 AACTATAAGCTATTTATAGGAGG No data
1114438048_1114438054 20 Left 1114438048 14:22724493-22724515 CCACGCCTCCTGGCCCTAGAATG No data
Right 1114438054 14:22724536-22724558 AACTATAAGCTATTTATAGGAGG No data
1114438047_1114438054 23 Left 1114438047 14:22724490-22724512 CCACCACGCCTCCTGGCCCTAGA No data
Right 1114438054 14:22724536-22724558 AACTATAAGCTATTTATAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114438054 Original CRISPR AACTATAAGCTATTTATAGG AGG Intergenic
No off target data available for this crispr