ID: 1114438295

View in Genome Browser
Species Human (GRCh38)
Location 14:22726283-22726305
Sequence TGGGGAAGACAGCAGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114438276_1114438295 26 Left 1114438276 14:22726234-22726256 CCATCAGCATCTCCCAGTCCATG No data
Right 1114438295 14:22726283-22726305 TGGGGAAGACAGCAGGGGCATGG No data
1114438286_1114438295 8 Left 1114438286 14:22726252-22726274 CCATGGGGGTTGAGGGGAGCAGG No data
Right 1114438295 14:22726283-22726305 TGGGGAAGACAGCAGGGGCATGG No data
1114438283_1114438295 14 Left 1114438283 14:22726246-22726268 CCCAGTCCATGGGGGTTGAGGGG No data
Right 1114438295 14:22726283-22726305 TGGGGAAGACAGCAGGGGCATGG No data
1114438285_1114438295 13 Left 1114438285 14:22726247-22726269 CCAGTCCATGGGGGTTGAGGGGA No data
Right 1114438295 14:22726283-22726305 TGGGGAAGACAGCAGGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114438295 Original CRISPR TGGGGAAGACAGCAGGGGCA TGG Intergenic
No off target data available for this crispr