ID: 1114441936

View in Genome Browser
Species Human (GRCh38)
Location 14:22755594-22755616
Sequence CTTGTAAGAAGGAGAAATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114441932_1114441936 0 Left 1114441932 14:22755571-22755593 CCTAATCCAATATGACTGGTGTC 0: 209
1: 805
2: 1640
3: 1986
4: 1974
Right 1114441936 14:22755594-22755616 CTTGTAAGAAGGAGAAATTTAGG No data
1114441931_1114441936 1 Left 1114441931 14:22755570-22755592 CCCTAATCCAATATGACTGGTGT 0: 235
1: 883
2: 1637
3: 2139
4: 1994
Right 1114441936 14:22755594-22755616 CTTGTAAGAAGGAGAAATTTAGG No data
1114441933_1114441936 -6 Left 1114441933 14:22755577-22755599 CCAATATGACTGGTGTCCTTGTA 0: 17
1: 305
2: 1025
3: 1902
4: 2420
Right 1114441936 14:22755594-22755616 CTTGTAAGAAGGAGAAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114441936 Original CRISPR CTTGTAAGAAGGAGAAATTT AGG Intergenic
No off target data available for this crispr