ID: 1114446866

View in Genome Browser
Species Human (GRCh38)
Location 14:22795357-22795379
Sequence AGCAATACTCAGATTGGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114446866 Original CRISPR AGCAATACTCAGATTGGGCA CGG (reversed) Intronic
901608699 1:10479361-10479383 AGCAATACCCTGTTTGGGGACGG + Intronic
903774070 1:25781708-25781730 TGCAATGCTCGGAATGGGCACGG - Intronic
906962345 1:50426236-50426258 AGCTACACTCAGGTTGGGAAGGG - Intergenic
912403495 1:109416812-109416834 ATGAGTACTCAGGTTGGGCATGG + Intronic
912895802 1:113587484-113587506 AGCGATACACAGGCTGGGCACGG - Intronic
912916933 1:113824935-113824957 CACAATACTAATATTGGGCAGGG - Intronic
913277278 1:117151174-117151196 TGTAACACTCAGGTTGGGCATGG - Intronic
916253904 1:162766741-162766763 AGTAATAAACAGATTGGGCGTGG + Intronic
916502542 1:165399265-165399287 AGCAAAACACAGAGTGGTCAGGG - Intergenic
916531073 1:165657117-165657139 AGCAAGACTCAGGCTGAGCATGG + Intronic
917464660 1:175265319-175265341 TGCAATAATAAGATTGGCCAGGG - Intergenic
917792898 1:178511077-178511099 ATCATTATTCAGACTGGGCATGG + Intergenic
918748078 1:188232120-188232142 AGCAACACTGAGAGTGGGCTAGG + Intergenic
918763612 1:188448831-188448853 AGCATTACTCAGCTTTGGCTGGG + Intergenic
918835076 1:189451928-189451950 AGCATTACTCACAATGGCCATGG - Intergenic
920160216 1:203991746-203991768 AACAAGAATCAGATTGGGCTGGG - Intergenic
923515141 1:234690943-234690965 AGTAATTCTGAGATTGGTCAAGG - Intergenic
924134779 1:240952898-240952920 AGCAATATTAAGTTTAGGCAAGG + Intronic
1070159109 10:73854921-73854943 AGAAATACTGAGATTGGGATGGG - Intronic
1070478783 10:76858564-76858586 AGAAAATCTCAGATTGGGAAAGG - Intergenic
1073890067 10:108091023-108091045 GGCAGTACTCACAGTGGGCACGG + Intergenic
1076648490 10:131970899-131970921 AGAAAAACTCAGATTGGATATGG - Exonic
1077662150 11:4079277-4079299 AGCAAGACTCCGGCTGGGCACGG + Intronic
1078606400 11:12780081-12780103 AAAATTACTCAGATTGGGAAGGG + Intronic
1080689616 11:34545442-34545464 ATCAATTATCAGAGTGGGCAAGG - Intergenic
1080778338 11:35407250-35407272 AGCACTACTCAGAAGGGACAGGG - Intronic
1080972450 11:37294758-37294780 AGAAATACTCAGATTTGTTAGGG - Intergenic
1083511083 11:63209926-63209948 AGCAATACCCAAATGAGGCAAGG + Intronic
1084268711 11:68017956-68017978 AGCAAGAAGCAGAGTGGGCAAGG - Intronic
1085002059 11:73046871-73046893 AGCAATACTGTGACTGGGCATGG - Intronic
1087827920 11:102787171-102787193 AAGAGTACTCAGATTTGGCAAGG - Intergenic
1094702663 12:32885235-32885257 ATGAACACTCAGATTGGGAAAGG - Intronic
1095458750 12:42418697-42418719 AGAACTACTTAGATTGGTCAGGG - Intronic
1096278072 12:50227811-50227833 ATAAATACTCAGAGTGGGCTGGG - Intronic
1097456361 12:59803489-59803511 AGCCAGACTCAGATAAGGCAAGG - Intergenic
1099983554 12:89635932-89635954 ATCCATACTCAGACTGGGGACGG + Intronic
1100867102 12:98868720-98868742 AGCAATAATCAGATGGGGTCAGG - Intronic
1103904871 12:124322038-124322060 AGCAAGACTCAGCTTTTGCAGGG + Intergenic
1104514455 12:129411643-129411665 AGCAATAATTAGGCTGGGCATGG - Intronic
1106031848 13:26011641-26011663 AGAAATAAACAGACTGGGCATGG + Intronic
1107673020 13:42766261-42766283 AGCAGCACTCATATTTGGCAGGG - Intergenic
1110417316 13:75267693-75267715 AAGAATACTCAGATGCGGCAGGG + Intergenic
1111395946 13:87671217-87671239 TGCAATTCTCGGATTGGGAAAGG - Intergenic
1112005070 13:95246489-95246511 AGCAATTATCAGATTTGGCTTGG + Intronic
1114062441 14:19030951-19030973 AGCAATATTCTGGCTGGGCATGG + Intergenic
1114099820 14:19369046-19369068 AGCAATATTCTGGCTGGGCATGG - Intergenic
1114446866 14:22795357-22795379 AGCAATACTCAGATTGGGCACGG - Intronic
1114857763 14:26470588-26470610 AGCAAAATTTAGATTTGGCAAGG + Intronic
1114989122 14:28264885-28264907 AGAAAAACTCAGATTGGATATGG + Intergenic
1115261627 14:31460378-31460400 AGAAATTCTCACATAGGGCATGG + Intergenic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1126616466 15:50586726-50586748 ATAAAAACTCAGACTGGGCATGG + Intronic
1127377149 15:58395241-58395263 GGCCATACTCAGATTTGGAAAGG - Intronic
1129675776 15:77631990-77632012 ACCAATACTCAGAATGGGAGGGG + Intronic
1130524380 15:84691362-84691384 AGAAATTCTCAGGCTGGGCACGG - Intronic
1133107615 16:3523414-3523436 AGCAATCCTCAGACTGACCAGGG - Intronic
1133165332 16:3942914-3942936 AGCAACACACAGGCTGGGCACGG + Intergenic
1134352955 16:13454964-13454986 TGCAATAGTGAGATTGGCCAAGG - Intergenic
1136012829 16:27375260-27375282 ACCAATCTTCAGATTGGGAAAGG - Intergenic
1136343245 16:29658849-29658871 AGCAATACTTAGGCTGGGCGTGG - Intergenic
1138912930 16:61424595-61424617 AGGAATGCTCAGATTTGGCCAGG + Intergenic
1139194618 16:64904780-64904802 AGCAATTCTCTGGGTGGGCATGG - Intergenic
1139711437 16:68779443-68779465 AGCAATACTCACAGTGGTAAGGG - Intronic
1140985738 16:80156648-80156670 GGCAAGACTCAGAGTGGGCAGGG + Intergenic
1143018943 17:3906478-3906500 AGAAACACTCAGAATGGGGATGG + Intronic
1143581059 17:7826317-7826339 AGTAAAACTCAGGCTGGGCACGG - Intronic
1145857973 17:28180961-28180983 AGAAATACTTAGGCTGGGCATGG + Intronic
1146627709 17:34446784-34446806 AGGAATACTCAAAGTGGGGAAGG - Intergenic
1146909235 17:36637636-36637658 AGCAATGCTGAGATAGGGGAAGG - Intergenic
1147203029 17:38816540-38816562 AGTCATATTCAGGTTGGGCATGG - Intronic
1150472186 17:65446713-65446735 AGAAATACTCAGGTTGGAGAAGG + Intergenic
1150931003 17:69585214-69585236 TGCAATACATAGGTTGGGCAGGG + Intergenic
1155584722 18:27351873-27351895 AAAAATCCTCAGACTGGGCATGG + Intergenic
1156642750 18:39122064-39122086 AGGAACCCTCAGGTTGGGCATGG + Intergenic
1157490500 18:48120464-48120486 AACAATACAAAAATTGGGCATGG + Intronic
1158359387 18:56654423-56654445 AGAAATACTCAGATTCGGCAGGG - Intronic
1161225172 19:3141128-3141150 AGCAACCCTCATATTGGGGAAGG + Intronic
1162548914 19:11347618-11347640 AGAACTACTCAGGCTGGGCACGG - Intronic
1163893094 19:20034084-20034106 AGGAATACTCAGATTAGATATGG + Intronic
1164661820 19:29980118-29980140 AGGAATATTAAGTTTGGGCATGG - Intronic
1165207395 19:34202094-34202116 AGCAATAATAAGGGTGGGCATGG - Intronic
1165803621 19:38567424-38567446 AGAAAGACTCAGAGTAGGCATGG - Intronic
1166429366 19:42711146-42711168 AGGAATACTCAGAGTGGGTGTGG + Intronic
1166468828 19:43059689-43059711 AGGAATACTCAGAGTTGGCGTGG + Intronic
925599042 2:5589340-5589362 GGCAATACTGAGAATGGGCGAGG + Intergenic
927948178 2:27149804-27149826 AGCAGGATTCAGATTGGGCATGG + Intronic
929832377 2:45357607-45357629 AGCAAAACTCAGGTTTTGCAAGG + Intergenic
930806312 2:55494119-55494141 AGTAATATTTGGATTGGGCATGG - Intergenic
931252190 2:60542731-60542753 AAAAATACTCAGTTTGGGCCAGG + Intronic
936739138 2:115483765-115483787 AAGAATAATCAGATTGGCCAAGG - Intronic
938462348 2:131505996-131506018 ATCAATAGTGAGGTTGGGCATGG - Intergenic
942737754 2:179135237-179135259 AACAATAGTCAGTTTGGGCCGGG - Intronic
944245096 2:197522619-197522641 AGTAATCATCAGACTGGGCATGG - Intronic
947064204 2:226201883-226201905 AGCAATTTCCAGATTGGGCAAGG - Intergenic
947853189 2:233305277-233305299 AGCAATGCTAAGATTGACCATGG + Intergenic
1170161279 20:13313790-13313812 AGCCAGACTCAGATATGGCAGGG + Intergenic
1174696853 20:52568492-52568514 AACAGTACTCACATTAGGCAGGG + Intergenic
1177254185 21:18638038-18638060 AGCAATATTCATATTAGGAAAGG + Intergenic
1177429013 21:20965211-20965233 AGCAATATTAAGTGTGGGCAAGG + Intergenic
1180480933 22:15753578-15753600 AGCAATATTCTGGCTGGGCATGG + Intergenic
1183764173 22:39855393-39855415 AGCAAGACACAGATTAAGCATGG - Intronic
1184367782 22:44063520-44063542 AGAAATATTCATATTGGGCCAGG - Intronic
1185211579 22:49573541-49573563 AGCAAGGCCCAGAGTGGGCAGGG + Intronic
953591864 3:44265269-44265291 AACAACATTCAGACTGGGCATGG + Intronic
954374767 3:50188455-50188477 AGCCCTACTCGGATGGGGCACGG + Exonic
960596905 3:119415086-119415108 AGCAGTCCACAGATTAGGCAAGG + Exonic
960622501 3:119650578-119650600 AACAATCATGAGATTGGGCAAGG - Intronic
961912434 3:130332939-130332961 ACTAATAATCTGATTGGGCAAGG + Intergenic
964869691 3:161299906-161299928 AGAAATGCTGAGATTGGGCCAGG + Intergenic
965784816 3:172324438-172324460 AGGAACACTCAGCTTGGGAAAGG + Intronic
970756406 4:19431703-19431725 AACCAGACTCAGATAGGGCAGGG + Intergenic
972440928 4:39090737-39090759 AGCCATACAAAGGTTGGGCATGG - Intronic
974625253 4:64418191-64418213 AGCAAGGCTCAGATTCGGGAAGG - Intergenic
977111476 4:92962148-92962170 AACCATACTCAGATAAGGCAGGG - Intronic
979095517 4:116545024-116545046 AGCAGTAATTAGTTTGGGCAGGG + Intergenic
981980647 4:150786934-150786956 AAAAATACTCAGATTCGGCCAGG + Intronic
982689837 4:158535557-158535579 AGCAATCCTTAGAGAGGGCATGG + Intronic
983362273 4:166742014-166742036 AGCAATATTCAGAAGCGGCAAGG - Exonic
985903811 5:2817640-2817662 AGGAAAACGCAGACTGGGCAAGG + Intergenic
987108271 5:14662147-14662169 AGAAATAATCAGATTTGTCAGGG - Intergenic
989384786 5:40844524-40844546 AGAAATATTCAGATTTGGCTAGG - Intronic
990188681 5:53233747-53233769 AGCTATAGTCAGACTGGGCATGG - Intergenic
990277879 5:54218176-54218198 AGTAACATTCAGATTGGCCACGG + Intronic
996548986 5:124710591-124710613 AGCAATATTCAGATTTTGCAGGG - Intronic
996850366 5:127944432-127944454 AGAATTTCTCAGGTTGGGCATGG - Intergenic
999739126 5:154536114-154536136 AGAAATACTGAGATTTAGCAAGG + Intergenic
1001221787 5:169906626-169906648 AGCAAAACTCAGTTTTGGCCAGG - Intronic
1001576403 5:172767129-172767151 AGCAATGGTCAGGTTGGGGATGG + Intergenic
1002127114 5:177054359-177054381 AAAAATAGCCAGATTGGGCATGG - Intronic
1003879686 6:10468775-10468797 AACAACACCCACATTGGGCACGG + Intergenic
1005254137 6:23981802-23981824 ATAAATACTCAGGTTGGGCCAGG + Intergenic
1005351608 6:24941285-24941307 GGCAAGACTCACATTGGGTATGG + Intronic
1005522054 6:26610328-26610350 GATAATACTCAGACTGGGCACGG - Intergenic
1005707952 6:28475083-28475105 AGCGATGCTCACATTGGGAAGGG - Intergenic
1006819222 6:36877689-36877711 AGCAATACTAAGAGTTGGCTTGG - Intronic
1010389913 6:75325123-75325145 AGAAGTAATCAGACTGGGCATGG + Intronic
1011463004 6:87625766-87625788 AGCAATACCAAGACTAGGCATGG - Intronic
1012045470 6:94266884-94266906 AGCAATACTCTGTTTGAACATGG - Intergenic
1013162174 6:107555398-107555420 AAAAATACTCAGATTTGGCAAGG - Intronic
1015350272 6:132210065-132210087 ATCTATACTCAGAAAGGGCAGGG + Intergenic
1016321694 6:142853725-142853747 AGCAAGACACAGATGGGCCAGGG + Intronic
1021123780 7:16826626-16826648 GGCAGTACTCACAGTGGGCATGG + Intronic
1021292517 7:18863900-18863922 AGCAGTACTCACAGTGGCCATGG - Intronic
1022516094 7:30975848-30975870 ACCAATACTGAGACTGGGTATGG - Exonic
1027160344 7:75797839-75797861 AGCAAGACTCTGGCTGGGCATGG - Intergenic
1028927109 7:96370322-96370344 AGCCAGACTCAGATATGGCAAGG - Intergenic
1029402612 7:100355337-100355359 AGCAGTTCTCAAAATGGGCAGGG + Intronic
1030825789 7:114156039-114156061 AGTAATACTCAGACTGGTAAGGG - Intronic
1031134240 7:117868773-117868795 AGCAATACTCAGACAGGCCTGGG + Intronic
1034286036 7:149883630-149883652 AGCAATGCGCAGATTGGACGAGG - Intergenic
1036941770 8:13058719-13058741 GGCAATACTCAGGCTGGGCTTGG + Intergenic
1038649944 8:29393479-29393501 AGCAATCATCATAGTGGGCAAGG + Intergenic
1039868002 8:41522540-41522562 AGAAATACTGAGTTTGGGCCGGG + Intergenic
1043046597 8:75331614-75331636 AGCAATACTAAGTATTGGCAAGG - Intergenic
1043550359 8:81364634-81364656 AGAAAAACTCAGATAGGGGAAGG + Intergenic
1047000392 8:120567302-120567324 GGTAATTCTCATATTGGGCAAGG + Intronic
1050383957 9:5064140-5064162 AGCAAGACTCTGACTGGGCGGGG + Intronic
1050534468 9:6619712-6619734 AGCAAGACTCCGTCTGGGCAGGG + Intronic
1050642348 9:7681729-7681751 AGCCTGACTCAGATTTGGCAAGG + Intergenic
1053017420 9:34670593-34670615 AGCAATAAGCAGTTTGGACAAGG + Intergenic
1057829900 9:98398427-98398449 AGCAAGACCCAGGTTGGGGATGG - Intronic
1057867960 9:98696341-98696363 AGCAATGCTGGGAGTGGGCAGGG + Intronic
1188063067 X:25624924-25624946 TGCAATACTCAGAATGTGGATGG + Intergenic
1192794560 X:74415969-74415991 AGGAATACATAGATTGGACAAGG - Intergenic
1195614514 X:106901925-106901947 ACCAAAGCTCAGAGTGGGCAAGG - Intronic
1198022515 X:132672872-132672894 AGCAAAACTCAGATTGGAGTGGG - Intronic
1199883300 X:151994009-151994031 AGTAATTCTCAGAGAGGGCAAGG + Intergenic