ID: 1114447934

View in Genome Browser
Species Human (GRCh38)
Location 14:22803863-22803885
Sequence CCTGTAGGGAACGCACAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114447934 Original CRISPR CCTGTAGGGAACGCACAGTG TGG (reversed) Intronic
902755161 1:18544582-18544604 CATGTGGGGAACACTCAGTGAGG + Intergenic
902974807 1:20080991-20081013 GCTGGAAAGAACGCACAGTGCGG - Intronic
904980406 1:34496449-34496471 TCTGGAGGGAAGGCACAGGGAGG + Intergenic
905295823 1:36953852-36953874 CCTGGAGGGGAAGCACAGAGGGG + Intronic
908561653 1:65311934-65311956 CCTCTAGGGGACTCTCAGTGGGG + Intronic
912373709 1:109193165-109193187 CCTAAAGGGAAGGAACAGTGGGG + Intronic
912575662 1:110670287-110670309 CCTTTAGGGAACTTACAATGTGG + Intergenic
917072738 1:171169990-171170012 TCTGCAGAGAATGCACAGTGAGG + Intergenic
917638706 1:176961395-176961417 CCTGTAGGGGAAGCAAAGTCAGG + Intronic
920651220 1:207838787-207838809 CCTGTTGGGAACACACAGCTGGG - Intergenic
920703382 1:208234461-208234483 CCTGTTGGAAATGCAGAGTGCGG - Intronic
920930114 1:210380237-210380259 CCTGTAATTAAAGCACAGTGGGG + Intronic
923689031 1:236175455-236175477 CCTCTGGGGAACGCACTGTCTGG - Intronic
1066654472 10:37685671-37685693 CCTGTAGGGTACCCAAAGTCCGG - Intergenic
1071353184 10:84767210-84767232 CCTGTAATGCACGCCCAGTGGGG - Intergenic
1074753578 10:116609061-116609083 TCTGTAGCGAAGACACAGTGCGG + Exonic
1077556035 11:3226513-3226535 CCTGAGGTGAACGCACTGTGTGG + Intergenic
1084876243 11:72135825-72135847 CCTGTAGGGGATGCAGGGTGGGG + Intronic
1084881113 11:72172321-72172343 CCTGTAGGGGATGCAGGGTGGGG + Intergenic
1085882787 11:80487644-80487666 CCTGGAGGGAATGCCCACTGTGG - Intergenic
1093978903 12:25453237-25453259 CCTGTTGGGAAGGTGCAGTGGGG - Intronic
1095217061 12:39561436-39561458 CCTGTAAGCAGCGCACAGTTGGG - Intronic
1100294258 12:93246158-93246180 CCTGTGGGGTAGGCAGAGTGTGG - Intergenic
1104272363 12:127293711-127293733 CCTGCAGGGCAAGCACAGAGAGG + Intergenic
1106079307 13:26487453-26487475 CCTGGAGTGATCGGACAGTGGGG + Intergenic
1108746288 13:53397903-53397925 CCTGGAGGGAAGGCAGAGTGGGG + Intergenic
1114447934 14:22803863-22803885 CCTGTAGGGAACGCACAGTGTGG - Intronic
1117985179 14:61379911-61379933 CATGTAGGGGACACACGGTGTGG + Intronic
1118318985 14:64742403-64742425 CCTGTAGACAGGGCACAGTGGGG - Exonic
1123107706 14:105850425-105850447 CCGTTAGGGAATGCATAGTGGGG - Intergenic
1123990872 15:25682420-25682442 CCTGCAGGAAACACACACTGGGG + Intronic
1128133321 15:65245193-65245215 CCTGTGGGGGAGGCACAGAGAGG + Intronic
1129257743 15:74343674-74343696 CCTGTAGGAAACCCACACTGTGG - Intronic
1132142330 15:99406141-99406163 CCTGTAAGGAAGGCACACTGTGG - Intergenic
1134001409 16:10785897-10785919 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1134046184 16:11102986-11103008 CTTGTGGTGAAGGCACAGTGAGG - Intronic
1141936942 16:87246574-87246596 TCTGTGAGGAACACACAGTGAGG + Intronic
1143621440 17:8082802-8082824 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1143988567 17:10937008-10937030 CCTATAGGAAACTCACAGTAGGG - Intergenic
1144729677 17:17519233-17519255 CCTGGAGGGGAAGAACAGTGGGG + Intronic
1146275362 17:31512705-31512727 CCTTTGGGGAAGGGACAGTGTGG - Intronic
1150733800 17:67718217-67718239 CCTGTTGGGGACGCTGAGTGAGG + Intronic
1153759133 18:8313281-8313303 CCTGAAAGGAAAGCACAGGGGGG - Intronic
1155457575 18:26035112-26035134 CCTGTAGGAAATTCACAGTATGG - Exonic
1159743806 18:72207637-72207659 GCTCTAGGGACAGCACAGTGAGG - Intergenic
1160812858 19:1020471-1020493 CCTGGAGGGAGCTGACAGTGAGG + Intronic
1160824632 19:1073959-1073981 CCTGTATGGACCGGGCAGTGAGG + Exonic
1163569034 19:18069453-18069475 CCTGCAGGGAAGGCACACAGCGG - Intronic
1166296964 19:41894185-41894207 ACTGTAGGGAAGGGACAGTGAGG - Exonic
1167737704 19:51306661-51306683 CCTGTATGGAACCCAGACTGGGG - Intergenic
1168612762 19:57814437-57814459 CCTGTAGGGAACAACCTGTGAGG - Intronic
1168667029 19:58211771-58211793 CCTTGAGGGAATGCCCAGTGTGG - Intronic
926856629 2:17263547-17263569 CCTGCATGGAACTTACAGTGTGG + Intergenic
927498404 2:23565617-23565639 CCTCTAGGGAAAGCCCATTGTGG + Intronic
927916296 2:26938802-26938824 CCTTCAGGGCACCCACAGTGTGG + Intronic
929449178 2:42025316-42025338 CCTGGAGGGAACTCAGAGAGAGG + Intergenic
933566807 2:83960564-83960586 CCAATCTGGAACGCACAGTGGGG - Intergenic
933983110 2:87569678-87569700 CCTCTAGGAAAAGTACAGTGAGG + Intergenic
936310734 2:111381116-111381138 CCTCTAGGAAAAGTACAGTGAGG - Intergenic
942247266 2:174019310-174019332 CCAGGAGGGAGGGCACAGTGGGG + Intergenic
1169116446 20:3069383-3069405 CCTGTAGGGAACCCAACCTGAGG - Intergenic
1169199506 20:3701408-3701430 CCTGGAGGAAACTGACAGTGGGG - Exonic
1171047782 20:21827088-21827110 CCTGCAGTGGACGCACAATGAGG - Intergenic
1172168140 20:32911458-32911480 CCTGTAGGGAGCACACAGCTGGG - Intronic
1172198216 20:33106651-33106673 CCTTCAGGGAACTCACAATGTGG + Intronic
1173180789 20:40804860-40804882 GCTGTAGGGAAAGGACAGGGTGG - Intergenic
1179588928 21:42392412-42392434 GCTGTGAGGAACGCAGAGTGAGG + Intronic
1181563342 22:23718199-23718221 CCAGTAGGGAAGGCACCGTGTGG + Intergenic
949624787 3:5853444-5853466 CCTGTTGGGAACTGACAGAGTGG + Intergenic
950250461 3:11461099-11461121 CCTTTAGGGAAGGCAAAGGGTGG + Intronic
961047308 3:123718362-123718384 CCTGCAGGGAGCTTACAGTGTGG + Intronic
962393379 3:134992736-134992758 CCCTCAGGGAACTCACAGTGTGG - Intronic
962434988 3:135357935-135357957 TCTGTAGGGAACCCACAAGGAGG - Intergenic
966642946 3:182210651-182210673 CCTTTTGGGAGCACACAGTGGGG - Intergenic
968660717 4:1797716-1797738 CCTGTAGGGACCCCGCAGTCAGG - Intronic
968689949 4:1985283-1985305 CCTGAAGTGACCCCACAGTGTGG + Intronic
970128004 4:12836014-12836036 ACTGAAGGGAAGGCACAATGTGG - Intergenic
973647719 4:52966995-52967017 CCTGGAGGGAAGGAAGAGTGTGG - Intronic
973835332 4:54803708-54803730 CCTGTTGGGAAGGGACAGGGAGG - Intergenic
975496740 4:75043906-75043928 CCTTTAGGGAAAGCAAACTGTGG + Intronic
977630278 4:99234992-99235014 CTTGTAGGGAATGCACATTAAGG + Intergenic
981237846 4:142438984-142439006 CCTTTAGGGAATGCACACTGTGG + Intronic
981554719 4:145980500-145980522 CCAGAAGGGAACACACAGAGAGG - Intergenic
983378348 4:166958326-166958348 ACTGTAAGGGAAGCACAGTGGGG - Intronic
984699790 4:182811496-182811518 CCTCTAGGCAATGCCCAGTGGGG + Intergenic
987064503 5:14275548-14275570 CCTATAGGGGAGGCACAGGGTGG - Intronic
987251577 5:16106421-16106443 CCTGTAGAGAGCTCACAGTATGG - Intronic
988844916 5:35117992-35118014 CCTGGATGAAACGGACAGTGGGG + Intronic
990164539 5:52979786-52979808 ACTGCATGGAAAGCACAGTGAGG - Intergenic
1001543069 5:172552609-172552631 CCTGGAGGGCACACACAGTCTGG + Intergenic
1007115986 6:39343637-39343659 CTTGTGGGGAGCACACAGTGAGG - Intronic
1007476764 6:42124402-42124424 CCTGTAGGGCACTGACAGGGAGG + Intronic
1010101036 6:72108582-72108604 CTTGTAGTTAACCCACAGTGAGG - Intronic
1010942558 6:81935766-81935788 CCTGTATGGAAAGGAAAGTGGGG - Intergenic
1011440585 6:87383001-87383023 ACTGTAGTGAACTCACAGGGAGG + Intronic
1014685045 6:124486795-124486817 CCTGAAGGCCGCGCACAGTGAGG - Intronic
1016309141 6:142714535-142714557 TCTCTAAGGAAAGCACAGTGGGG + Intergenic
1016935005 6:149443194-149443216 CCTGGAGGTAACTCACTGTGAGG + Intergenic
1018028828 6:159826270-159826292 ATTGTAGGGAAGGCACACTGGGG - Intergenic
1019898475 7:4001122-4001144 CCTGTGGTGACCGCACGGTGCGG + Intronic
1020021761 7:4873553-4873575 CCTGCAGGGCAGGCCCAGTGAGG - Intronic
1021928305 7:25554247-25554269 CCAGGAGGGAAGGCACAGGGTGG - Intergenic
1022975572 7:35552817-35552839 CCTATAGGGAAAACACAGTAAGG + Intergenic
1024202737 7:47122819-47122841 CCTGGGGGGCAGGCACAGTGGGG + Intergenic
1025929604 7:65983063-65983085 CCAGTAGGGAAGGCACCGTGTGG + Intergenic
1028331948 7:89605508-89605530 CCTGGAGGGATCCCACAGAGTGG + Intergenic
1035395396 7:158531519-158531541 CCTGTGGGGAAGGCACCATGAGG + Intronic
1038373620 8:27015923-27015945 CCTGTAGGGAACACAGAATTTGG + Intergenic
1038626781 8:29201866-29201888 CATGTATGGAAAGTACAGTGGGG - Intronic
1039814035 8:41076314-41076336 TCTACAGGGAATGCACAGTGAGG + Intergenic
1042004749 8:64168728-64168750 GCTGTAGGGAGGGCACAGGGAGG + Intergenic
1048412017 8:134184945-134184967 TCAGTAGGGAACACAAAGTGGGG + Intergenic
1048852666 8:138659617-138659639 CCTCTAGGGAAGGAGCAGTGGGG - Intronic
1052230591 9:26146151-26146173 ACTGGAAGGAACGCACACTGGGG - Intergenic
1052421426 9:28247592-28247614 CCTGTAGGGAAGGGACAAAGTGG + Intronic
1056614925 9:88156870-88156892 CCTGTAGGCAACATACAGTTAGG + Intergenic
1061309515 9:129753065-129753087 CCTGCAGGGAAAGCACAAAGTGG + Intergenic
1061720205 9:132546679-132546701 CCTGGAGGGAATGCACAGTGGGG - Intronic
1189395908 X:40622760-40622782 CCTGTGGGGAACGCAGGCTGAGG + Intergenic
1199556909 X:149119465-149119487 CTTGAGGGGAACTCACAGTGGGG + Intergenic
1199802080 X:151261746-151261768 CTTGTAGGGAATGCACATTAAGG + Intergenic