ID: 1114450066

View in Genome Browser
Species Human (GRCh38)
Location 14:22819610-22819632
Sequence AGGTGGGAGAGGAGGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1317
Summary {0: 1, 1: 0, 2: 8, 3: 123, 4: 1185}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114450066_1114450076 5 Left 1114450066 14:22819610-22819632 CCATTGTCCCTCCTCTCCCACCT 0: 1
1: 0
2: 8
3: 123
4: 1185
Right 1114450076 14:22819638-22819660 CTGTCCAGTGACCTTTGGGCAGG 0: 1
1: 0
2: 3
3: 14
4: 154
1114450066_1114450073 0 Left 1114450066 14:22819610-22819632 CCATTGTCCCTCCTCTCCCACCT 0: 1
1: 0
2: 8
3: 123
4: 1185
Right 1114450073 14:22819633-22819655 CTTACCTGTCCAGTGACCTTTGG 0: 1
1: 0
2: 1
3: 34
4: 314
1114450066_1114450084 19 Left 1114450066 14:22819610-22819632 CCATTGTCCCTCCTCTCCCACCT 0: 1
1: 0
2: 8
3: 123
4: 1185
Right 1114450084 14:22819652-22819674 TTGGGCAGGTGCGGGGAGGAGGG 0: 1
1: 0
2: 4
3: 60
4: 725
1114450066_1114450078 10 Left 1114450066 14:22819610-22819632 CCATTGTCCCTCCTCTCCCACCT 0: 1
1: 0
2: 8
3: 123
4: 1185
Right 1114450078 14:22819643-22819665 CAGTGACCTTTGGGCAGGTGCGG 0: 1
1: 0
2: 2
3: 32
4: 347
1114450066_1114450081 15 Left 1114450066 14:22819610-22819632 CCATTGTCCCTCCTCTCCCACCT 0: 1
1: 0
2: 8
3: 123
4: 1185
Right 1114450081 14:22819648-22819670 ACCTTTGGGCAGGTGCGGGGAGG 0: 1
1: 0
2: 1
3: 17
4: 246
1114450066_1114450074 1 Left 1114450066 14:22819610-22819632 CCATTGTCCCTCCTCTCCCACCT 0: 1
1: 0
2: 8
3: 123
4: 1185
Right 1114450074 14:22819634-22819656 TTACCTGTCCAGTGACCTTTGGG 0: 1
1: 0
2: 0
3: 14
4: 157
1114450066_1114450080 12 Left 1114450066 14:22819610-22819632 CCATTGTCCCTCCTCTCCCACCT 0: 1
1: 0
2: 8
3: 123
4: 1185
Right 1114450080 14:22819645-22819667 GTGACCTTTGGGCAGGTGCGGGG 0: 1
1: 0
2: 1
3: 9
4: 154
1114450066_1114450085 20 Left 1114450066 14:22819610-22819632 CCATTGTCCCTCCTCTCCCACCT 0: 1
1: 0
2: 8
3: 123
4: 1185
Right 1114450085 14:22819653-22819675 TGGGCAGGTGCGGGGAGGAGGGG 0: 1
1: 0
2: 10
3: 168
4: 2009
1114450066_1114450079 11 Left 1114450066 14:22819610-22819632 CCATTGTCCCTCCTCTCCCACCT 0: 1
1: 0
2: 8
3: 123
4: 1185
Right 1114450079 14:22819644-22819666 AGTGACCTTTGGGCAGGTGCGGG 0: 1
1: 0
2: 0
3: 21
4: 215
1114450066_1114450083 18 Left 1114450066 14:22819610-22819632 CCATTGTCCCTCCTCTCCCACCT 0: 1
1: 0
2: 8
3: 123
4: 1185
Right 1114450083 14:22819651-22819673 TTTGGGCAGGTGCGGGGAGGAGG 0: 1
1: 0
2: 2
3: 64
4: 654

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114450066 Original CRISPR AGGTGGGAGAGGAGGGACAA TGG (reversed) Intronic
900001492 1:17212-17234 AGGTGGGAGGGGTGGGACAGAGG - Intergenic
900021211 1:187734-187756 AGGTGGGAGGGGTGGGACAGAGG - Intergenic
900088169 1:908550-908572 GCGGGGGAGAGGAGGGAAAAGGG + Intergenic
900088271 1:908783-908805 AGGTGGGAGGGGAGGGAATGAGG + Intergenic
900115358 1:1025748-1025770 AGGTGAGTGGGGAGGGACAGAGG - Intronic
900479218 1:2890028-2890050 AGGTGGTAGAGGAAGGTGAAGGG + Intergenic
900623029 1:3596110-3596132 AGGTCAGAGAGGAGGCACCATGG + Intronic
900892331 1:5458462-5458484 AGGAGGGAGAGAAGGGAGGAGGG - Intergenic
900940408 1:5795047-5795069 GGGAGGGAGAGGAGGGGCAAAGG + Intergenic
900977598 1:6026961-6026983 AGGGGAGAGAGGAGGGACTGGGG - Intronic
901216654 1:7559003-7559025 CTTTGGGAGAGGAGGGACAAAGG + Intronic
901447911 1:9319411-9319433 AGGAGGAAGAGGAGGGAGGAAGG - Intronic
901662595 1:10807974-10807996 AGGTGGGGAAGGGAGGACAAAGG - Intergenic
902270298 1:15299558-15299580 AGGTGGGACAGGAAGGATCAGGG + Intronic
902431526 1:16367227-16367249 GGGTGGGGGAGGAGGGAAAGCGG + Exonic
902614908 1:17618482-17618504 AGGAGGAGGAGGAGGGACAGCGG - Intronic
902722758 1:18315035-18315057 AGAGGGGAGAGCAGGGACAAGGG + Intronic
902920837 1:19665298-19665320 AGGTGGGTGAGGGGGGTGAATGG - Exonic
902979489 1:20112898-20112920 TGGTGGGAGAGGTGGGGCAGGGG + Exonic
902985755 1:20153130-20153152 AGGAGGGAGAGGATGTAGAAAGG + Intergenic
903186274 1:21631084-21631106 GGGTGGGATAGGAGAGAGAAGGG - Intronic
903363291 1:22790590-22790612 AGGTGGGTAAGGAGAGACCAAGG - Intronic
903478774 1:23638200-23638222 AGGAGGGAGAGGAGAGAGAGAGG + Intronic
903743943 1:25574196-25574218 AGGCTGGAGAGGAGGGAGGAAGG + Intergenic
903751254 1:25622336-25622358 AGGTGGAAGAGAAGAGAGAAGGG - Intronic
903795599 1:25927006-25927028 AGGTGGGAGAGGAGGGGCTTAGG - Intergenic
903834598 1:26195179-26195201 TGGTGGGAGAAGAGGGATGAGGG - Intronic
903991005 1:27269524-27269546 ACGTGGAAGACGATGGACAATGG + Intronic
904136668 1:28317856-28317878 AGGTGGGAGAGAAGTGAGAATGG - Intergenic
904383850 1:30129061-30129083 AGGTGGGAGGGGGTGGGCAATGG + Intergenic
904398036 1:30236218-30236240 AGCTGGGAGAGGAAGCGCAATGG - Intergenic
904535844 1:31198872-31198894 AGGTGGGGAGTGAGGGACAAGGG + Intronic
904653054 1:32020792-32020814 TGGTGAGAGATGAGGGAAAACGG + Intronic
904686838 1:32266723-32266745 AGGAGGGGGAGGAGGGGGAAGGG - Intronic
904686863 1:32266770-32266792 AGGAGGGGGAGGAGGGGGAAGGG - Intronic
904696862 1:32335901-32335923 AGGTGCGAGAGGAGGGGCTGGGG + Intronic
905150099 1:35920449-35920471 GGGTGGGAGAGGAGGTAGATGGG + Exonic
905341431 1:37280679-37280701 AGGTGGGGAAAGAGTGACAAAGG - Intergenic
905393170 1:37650995-37651017 AGGTGGGAGAGCAGTGAGAGAGG + Intergenic
905673300 1:39807633-39807655 ACGAGGGAGACGAGGGACGAGGG - Intergenic
905854811 1:41302591-41302613 AAATGGGACAGGAGGGTCAATGG - Intergenic
906090252 1:43172568-43172590 AGGGGAAAGGGGAGGGACAAGGG + Exonic
906090263 1:43172592-43172614 AGGGGAAAGGGGAGGGACAAGGG + Intronic
906583580 1:46956313-46956335 AGCTGGGTGTAGAGGGACAACGG - Intergenic
906936882 1:50222075-50222097 AGTTGGGAGAGGGAGGAGAAAGG - Intergenic
907391003 1:54158222-54158244 AGGTGGTAGAGAGGGAACAAAGG + Intronic
907546008 1:55260610-55260632 AGGTGGCAGTGGAGGGGCATAGG + Intergenic
907561548 1:55394663-55394685 AGGAGGCAGAGGAAGGAGAATGG - Intergenic
907670561 1:56471339-56471361 AGGATGGAGAGGAGGGAAGAAGG + Intergenic
907692631 1:56684806-56684828 AGGCAGGAGAGGAGAGACATAGG + Intronic
907937203 1:59052906-59052928 TGGTGGGAGAGACGGAACAATGG - Intergenic
908476525 1:64494020-64494042 GGGAGGGAGCGGTGGGACAAGGG + Intronic
908559524 1:65291932-65291954 AGGTGGGAAAAAAGTGACAACGG - Intronic
908632358 1:66123505-66123527 AGGGAGGGGAGGAGGGAGAAAGG - Intronic
908745814 1:67375538-67375560 AGGTTGAGGAGGAGGGAGAAAGG + Intronic
909234610 1:73136750-73136772 AGGTGGTAGTGTGGGGACAAAGG + Intergenic
909239601 1:73195594-73195616 AGGAGGCTGAGGAGGGAGAATGG - Intergenic
910524567 1:88163375-88163397 AGGTGAAAGAAGTGGGACAAAGG + Intergenic
912303117 1:108536848-108536870 AGGAGGGAGAGGAGGGAGACGGG + Intergenic
912429373 1:109620950-109620972 AGGAGGCAGGGGAGGGATAAGGG + Exonic
912512795 1:110199986-110200008 AGGAAGGAAAGGAGGGAGAAAGG + Exonic
912624800 1:111198062-111198084 AGGGTGGAGAGGAGGGCAAAGGG + Intronic
913162510 1:116157073-116157095 AGGTGGGAGTGGAGGGGCAAGGG - Intergenic
913318708 1:117574209-117574231 AGGGAGGAGAGGAGGGTGAATGG - Intergenic
913380082 1:118201154-118201176 AGGAGAGAGAGGAGGGAGAGGGG - Intergenic
913457689 1:119050129-119050151 TGGCTGGAGAAGAGGGACAAAGG - Intronic
913480101 1:119280061-119280083 TGGTGGGAGAGGAAGGCCAGGGG - Intergenic
913578699 1:120204301-120204323 AGGAGGTAGGGGAGGGAGAATGG - Intergenic
913629474 1:120694068-120694090 AGGAGGTAGGGGAGGGAGAATGG + Intergenic
914194487 1:145438513-145438535 AGGAGGCCGAGGAGGGAGAATGG + Intergenic
914220749 1:145679853-145679875 AGGTTGGAGAGAGGTGACAAGGG - Intronic
914397755 1:147287011-147287033 AGGTGGGACAGGTGTGATAAAGG - Intronic
914444834 1:147741010-147741032 ATGTGGGAGAGAAGGGAATATGG - Intergenic
914473325 1:148002726-148002748 AGGTTGGAGAGAAGTGACAAGGG - Intergenic
914560628 1:148815742-148815764 AGGAGGTAGGGGAGGGAGAATGG - Intronic
914612206 1:149314473-149314495 AGGAGGTAGGGGAGGGAGAATGG + Intergenic
915226924 1:154418484-154418506 ATGTGGGGGAGGAGGGAGCAGGG + Intronic
915444496 1:155967030-155967052 AGGTGGGAGGAGAGGGACTGGGG - Intronic
915943040 1:160130802-160130824 GGGAGGGAGAGGAGGGGCATGGG - Intronic
916368178 1:164057731-164057753 AGGAGGGGGAGGAGGAGCAAAGG - Intergenic
916415498 1:164588820-164588842 TGGTGGGGGCGGAGGGATAAAGG - Intronic
916944427 1:169711680-169711702 AGGAGGAAGGGGAGGGAAAAGGG - Exonic
917637132 1:176948294-176948316 GGGAGGGAGAGGGGGGAGAATGG + Intronic
917710840 1:177682534-177682556 AGATGGCAGAGGGGGGAGAAAGG + Intergenic
917732907 1:177893915-177893937 GGGAGGGAGGGAAGGGACAAGGG + Intergenic
917790563 1:178496385-178496407 AGGTGGGAGGGGAGGGCGCAGGG - Intergenic
917836899 1:178948210-178948232 AGGTTGGAGAGGGTGGACACAGG - Intergenic
918149147 1:181783076-181783098 AGGTGGAGCAGGATGGACAAGGG - Intronic
918216530 1:182396657-182396679 AGGTGGGAGGGGAGGGAGGAAGG - Intergenic
918248481 1:182681176-182681198 GGATGGGACAGGAGGGCCAAAGG + Intronic
919034988 1:192294832-192294854 AGGTGGGAGAAGGAGCACAATGG + Intergenic
919102247 1:193109008-193109030 AGGTGGGGGCAGAGGGAGAAGGG + Intergenic
919971000 1:202578545-202578567 AGGTAGGAGACCAGGGTCAAAGG + Intronic
920095987 1:203487173-203487195 GGGTGGGGGAGGAGAGAGAAGGG - Exonic
920255610 1:204652218-204652240 AGGGGAGAGAGGAGGGGGAAGGG - Intronic
920353898 1:205356392-205356414 ATGGGGGTCAGGAGGGACAAGGG - Intronic
920403685 1:205693400-205693422 AGATGGTGGAGGAAGGACAAGGG + Intergenic
920708050 1:208269180-208269202 AAGGGGGTGAGGAGGGAGAAGGG + Intergenic
920795699 1:209134132-209134154 AGGTGAGACAGGAGGGCCAGAGG - Intergenic
921099154 1:211913148-211913170 AGGTGTGAGAGGGGAGACAAAGG - Intergenic
921610696 1:217209290-217209312 AGGTGGGAGGAGAGAGAGAATGG - Intergenic
921790132 1:219280483-219280505 AGGTGGGAGAGGGGAGATGAAGG + Intergenic
922176591 1:223202344-223202366 AGCTGGAGGAGGAGGGAAAAAGG - Intergenic
922293671 1:224230069-224230091 AGGAGGCAGAGGTGGGAGAATGG - Intronic
922574889 1:226654944-226654966 AGGAGGAAGAGGAGGGAGGAGGG + Intronic
922804333 1:228377840-228377862 AGGTGGGATAGGTGGGGCACAGG - Intronic
923270826 1:232353774-232353796 GGGCGGGAGAGGAGGGGGAAAGG - Intergenic
923736151 1:236609786-236609808 GGGGAGGAGATGAGGGACAAAGG + Intergenic
924483948 1:244461643-244461665 GGGTGGGAGCGGTGGGACACTGG - Intronic
924736347 1:246760580-246760602 TGGGGGCAGAGGAGGCACAAAGG - Intronic
1062908904 10:1199566-1199588 AGGTGGGCGAGGAGGGGCGGGGG - Intronic
1063121345 10:3106996-3107018 AGGGGTGAGAGGAGGGGCAGGGG - Intronic
1063362402 10:5469160-5469182 GGGAGGGAGTGGAGGGAGAAAGG - Intergenic
1063365323 10:5487004-5487026 AGGTGGGAGGGGAGTGAGCAGGG - Intergenic
1063379938 10:5577984-5578006 AGGTGCCAGAGGAGGGACAAAGG - Intergenic
1063443265 10:6089982-6090004 AGATGTGAGAGGTGGGAAAAAGG + Intronic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1063614563 10:7590757-7590779 ACGTGGAAGCGGAGCGACAAAGG + Intronic
1063938949 10:11107822-11107844 AGGGGGCAGAGGAGGGAGGAGGG - Intronic
1064218013 10:13416739-13416761 GGGTGACAGAGGAGGGAGAAGGG + Intergenic
1065198162 10:23286635-23286657 AGGGAGGAAAGGAGGGAGAAAGG + Intronic
1065532515 10:26686840-26686862 AGGAGGCTGAGGAGGGAGAATGG + Intergenic
1066330005 10:34411150-34411172 AGATGGGGGAGGAGGGAGATAGG + Intronic
1067041513 10:42955636-42955658 AGGAGGGAGTGGAGGCACTAAGG - Intergenic
1067252677 10:44601093-44601115 TGCAGGGAGAGGAGGGAAAAAGG + Intergenic
1067358182 10:45550696-45550718 AGGTGGGACAGAATGAACAAGGG - Intronic
1067423115 10:46175622-46175644 AGGTGGGAGAGTATAGATAAGGG + Intergenic
1067720305 10:48723126-48723148 AGGGTGGAAAGGAGGGAAAAGGG - Intronic
1067833214 10:49622012-49622034 AGGAGGGAGGGGAGGCAGAAGGG + Intronic
1067844604 10:49709846-49709868 TGCTGGGAGAGAAGGGAGAAGGG - Exonic
1068072239 10:52209734-52209756 AGATGGGTGATGAGGGAGAAGGG - Intronic
1068094489 10:52473218-52473240 GGGTAGGAGAAGAAGGACAAAGG + Intergenic
1068189731 10:53635545-53635567 AGGTGAGAGAGCAGGGAACAAGG + Intergenic
1068956573 10:62823895-62823917 AGGTGGGAGAGGAGTCAGGAAGG - Intronic
1069117995 10:64532264-64532286 AAGAGGGAGAGGAGAGACAGAGG - Intergenic
1069190590 10:65483158-65483180 AGGCGGGAAAGGAGGAAGAAAGG - Intergenic
1069274012 10:66567010-66567032 AAGTGGGAGAAAAGGGACAAAGG + Intronic
1069793823 10:71040002-71040024 GCGGGGGAGAGGAGGGAGAATGG + Intergenic
1069837681 10:71319455-71319477 AGGAGAGAGAGGAGGGACGGTGG - Intronic
1069848149 10:71387133-71387155 AGGAGGCAGAGGTGGGAGAATGG - Intergenic
1070161340 10:73868366-73868388 AGGTGGGAGGGGAGGGGGACAGG + Intronic
1070618283 10:77986453-77986475 ACGTGGGAGAGCAAGAACAAAGG - Intronic
1070702422 10:78613436-78613458 AGGAGGGAGAGAAGGAAGAAAGG + Intergenic
1070878272 10:79836904-79836926 AGGTGGGAGAGTATAGATAAGGG - Intergenic
1071263220 10:83939945-83939967 AGGAGGGAAAGAAGGGAGAAAGG + Intergenic
1071270632 10:84003682-84003704 AAGTGGGAGAGAAAGTACAAAGG - Intergenic
1071468430 10:85961579-85961601 AGGAGGGAGAGAAGGTAAAAAGG - Intronic
1071644820 10:87353221-87353243 AGGTGGGAGAGTATAGATAAGGG - Intergenic
1071870992 10:89794534-89794556 GGTCGGGAGTGGAGGGACAAGGG - Intergenic
1072076979 10:91986619-91986641 AGTAGGGAGAGGAGGCAAAAAGG - Intronic
1072471769 10:95719982-95720004 AGCTGGGTATGGAGGGACAATGG + Intronic
1072770269 10:98132093-98132115 AGGTGGGAGAGAAGGGGAAAGGG + Intergenic
1072801461 10:98395166-98395188 AGGGGGGTGAGGTGGGACACAGG - Intronic
1072821632 10:98564045-98564067 AGGAGGGCTGGGAGGGACAAAGG - Intronic
1073268450 10:102242076-102242098 AAGTGGCAGAGGAAGGAGAATGG - Intergenic
1073290883 10:102412668-102412690 GGGAGGGAGTGGAGGGACATGGG + Intronic
1073483397 10:103801149-103801171 AGGTGGGAGCAGAGGGACAGAGG - Intronic
1073531013 10:104232100-104232122 CGGAGGGAGAGGAGGGAGGAGGG + Intronic
1073597796 10:104817606-104817628 AGGAGGGAGAGGAGGAAGAAGGG - Intronic
1073599932 10:104836713-104836735 AGGTGGGAAACAAGGCACAAAGG - Intronic
1073615362 10:104989766-104989788 CAGTGGAAGAGGAGGCACAATGG + Intronic
1073638310 10:105221957-105221979 AGTTAGGAAAGGAGGGAAAAAGG + Intronic
1074081976 10:110175311-110175333 AGGTACCAGAGGAGGGAGAAAGG + Intergenic
1074142863 10:110690541-110690563 AGCTGGGGGAAGAGGGACATGGG - Intronic
1074249707 10:111732402-111732424 AAGTGGGAGGGGAGGGACTGTGG - Intergenic
1074552294 10:114455915-114455937 AGGAGGGTGAGGCGGGAGAATGG - Intronic
1074712129 10:116186029-116186051 AGGTGGGAGAGCAAGAACCAAGG + Intronic
1075273745 10:121075678-121075700 AGGGGAGAGAGAAGGGAGAAAGG - Intergenic
1075364322 10:121870634-121870656 AGGTGAGAGAGAAGGGAGAAAGG - Intronic
1075365834 10:121887914-121887936 AGGTGGGAGAGGTAGCAAAATGG - Intronic
1075396367 10:122130582-122130604 AGGTGGAAGAGGAAGGAAGAGGG - Intronic
1075747670 10:124739086-124739108 AGAGGGGAGAGGAGGGGAAAAGG + Intronic
1075844675 10:125535677-125535699 AGGTGAGAGAGGAGAGAGAGAGG - Intergenic
1076063480 10:127430605-127430627 AGGTGGGGGAGGAGGGGCTGGGG - Intronic
1076166504 10:128286720-128286742 GAGCGGGAGAAGAGGGACAAGGG - Intergenic
1076220853 10:128732007-128732029 AGTTGGGAGAGCAGAGCCAAGGG + Intergenic
1076252359 10:128994633-128994655 AGGAGGGAAAGGAGGAAAAAAGG + Intergenic
1076318882 10:129564223-129564245 AGGGGGAAGAGGAGGGGGAAGGG - Intronic
1076346081 10:129780020-129780042 AGGAGGGAGAGGGGGGAGAGGGG - Intergenic
1076494912 10:130890753-130890775 AAGTGGGAAAGGAGGGGGAAGGG + Intergenic
1076523332 10:131094711-131094733 AGGAGGGAGAGAAGGAAGAAAGG - Intronic
1077008209 11:369086-369108 AGGAGGGAGGGGAGGGACCCGGG - Intergenic
1077211683 11:1374028-1374050 AGCGGAGTGAGGAGGGACAATGG - Intergenic
1077294818 11:1821321-1821343 AGGAGGGAGAGAAGGCAAAATGG + Intergenic
1077310562 11:1887155-1887177 AGGCGGGAGAGAAGGGCCCAGGG + Intronic
1077392524 11:2306791-2306813 AGGAGGAAAAGGAGGGAAAAGGG + Intronic
1077593892 11:3514862-3514884 AGGTGGGAGAGTAGCCACAGAGG + Intergenic
1077792075 11:5451760-5451782 AGGTTGGAGAGGAAAGAGAAAGG + Intronic
1077903966 11:6514452-6514474 AGGAGGGAGAGGAGAGAGAGAGG - Intronic
1077914690 11:6603696-6603718 CGGTGGGAGGGGAGGGACGGAGG + Intronic
1077950182 11:6948441-6948463 ATATGGGAGACGAAGGACAATGG + Intronic
1078467526 11:11561196-11561218 AGAAGGGAGGGGAGGGAAAAGGG + Intronic
1078480078 11:11667899-11667921 AGCTTGGAGAGGAGGGTCAGTGG + Intergenic
1078549129 11:12268479-12268501 AGGTGGCAGATGTGAGACAAGGG + Intergenic
1078651852 11:13202592-13202614 AGGCGGGAGGGAAGGGGCAAAGG + Intergenic
1079289920 11:19178785-19178807 AAGTGTGAGAGGAAGGAGAAGGG + Intergenic
1079370968 11:19851912-19851934 AGGTGAGAGAGATGTGACAATGG + Intronic
1079993871 11:27274764-27274786 AGGTGGGACAGGAGGAGAAAAGG + Intergenic
1079993980 11:27275779-27275801 AGGTGGGACAGGAGGAGAAAAGG - Intergenic
1080313546 11:30922999-30923021 AGGTGGGAAAGAAGGGAGCAAGG + Intronic
1080791424 11:35525618-35525640 GGGAGGGAGAGGAGGGACCCAGG + Exonic
1080880819 11:36318805-36318827 AGGTGAGAGAGAAGGGAAATGGG + Intronic
1081296552 11:41397249-41397271 AGGTGGAAGAGGAGGCAGGAGGG - Intronic
1081589406 11:44410604-44410626 AGGTAGGCAAGGAGGGAGAAAGG + Intergenic
1081730148 11:45366114-45366136 AGTTGGCAGATGAGGAACAAGGG - Intergenic
1081831796 11:46121132-46121154 AGGAGGAGGAGGAGGGAGAAGGG - Intronic
1082933981 11:58637853-58637875 AGGTGGGAGAGAAGAGAGAATGG - Intergenic
1083004077 11:59324846-59324868 GGAAGGGAGAGGAGGGACAAGGG - Intergenic
1083489316 11:63003459-63003481 AGGAGATGGAGGAGGGACAAAGG + Intronic
1083768766 11:64854862-64854884 GGGCGGGGGAGGAAGGACAAGGG + Intronic
1083887276 11:65579048-65579070 AGGGGGAAGGGGAGGGAGAAAGG - Intronic
1083988584 11:66232926-66232948 AGGGAGGAGAGCAGGGACACAGG - Intronic
1084157626 11:67323001-67323023 AGGGAGGAGAGGAGGGAAAGAGG - Intronic
1084208855 11:67611691-67611713 AGGTGGAAGAGGAGGGAGGAAGG + Intronic
1084408262 11:68991452-68991474 AGGTGGCAGGTGGGGGACAATGG - Intergenic
1084441919 11:69179455-69179477 AGGTGGGAGAGTAGGGACCTGGG - Intergenic
1084823109 11:71707901-71707923 AGGTGGGAGAGTAGCCACAGAGG - Intergenic
1084869925 11:72091471-72091493 AGGTGGGGGTGGAAGGGCAAAGG + Intronic
1085042544 11:73335023-73335045 AGCTGGGAGAGGAGGGCCCCTGG + Intronic
1085200296 11:74697757-74697779 AGGAGGGAGAGGAGGAAGAAAGG + Intronic
1085277960 11:75312090-75312112 AGATGGGAGAGGAGAGGCCATGG - Intronic
1085316946 11:75551023-75551045 AGGGGGAAGAGCAGGGGCAAAGG - Intergenic
1085569603 11:77547805-77547827 AGGTGGCTGAGGTGGGACGATGG - Intronic
1087497086 11:98905857-98905879 AGGTGGGAGGGGATGGTCAATGG - Intergenic
1088165711 11:106933950-106933972 GGATGGGAAAGGGGGGACAAGGG + Intronic
1088568522 11:111198162-111198184 AGGTGTTAGAGGAGGCACGAAGG - Intergenic
1088599495 11:111462291-111462313 ATGTAGGACAGAAGGGACAAAGG - Intergenic
1088922194 11:114268299-114268321 AGCTGGGAGAGGCTGGAAAAAGG - Intronic
1088969311 11:114758258-114758280 AGCATGGAAAGGAGGGACAATGG + Intergenic
1088984708 11:114895432-114895454 AGGTGGGTGAAGAGGGAAAGAGG - Intergenic
1089189228 11:116642006-116642028 AGGAGGCAGAGCAGAGACAAAGG + Intergenic
1089237383 11:117042355-117042377 AGGTAAGAAAGGAGGCACAATGG + Intronic
1089709097 11:120302261-120302283 GGGTGAAAGGGGAGGGACAAAGG - Intronic
1089745331 11:120612912-120612934 AGGTAGGGGAGGAGGGTCATGGG + Intronic
1089775202 11:120831025-120831047 GGGTGGGAGAGGAGGGAGTGAGG + Intronic
1089932983 11:122333170-122333192 AGGTGGGAAAGGAAAGAGAAGGG - Intergenic
1090068766 11:123525944-123525966 AGCTGGGAGAGGGGGAAGAAGGG + Exonic
1090636025 11:128691041-128691063 AGGAGGGAGAGGAGAGGGAAGGG + Intronic
1090785643 11:130044902-130044924 AGGAGGGAGAGGAGGGAGACGGG + Intergenic
1091072664 11:132583155-132583177 AGGTGGGAGAGGTGGGAGGATGG - Intronic
1091324422 11:134675332-134675354 AGGTAGAAAAGGAGGAACAAAGG - Intergenic
1091374577 12:17327-17349 AGGTGGGAGGGGTGGGACAGAGG - Intergenic
1091760091 12:3081439-3081461 AGGTGGAAGAGGATGAACTAAGG - Intronic
1091828666 12:3534035-3534057 AGGTGGGCAAGGAGGGAAGAAGG + Intronic
1091908051 12:4205347-4205369 CAGTGGGAGAGCAAGGACAAAGG + Intergenic
1091969487 12:4773573-4773595 TGGTGGGAGAGGAGGTAGGATGG + Intronic
1092049806 12:5460345-5460367 TGGTGGCAGAGGAGGGAGGAGGG - Intronic
1092201089 12:6583358-6583380 AGGAGGAAGAGGAGGTAGAACGG - Exonic
1092686952 12:11059154-11059176 ATGAGAGAGAGGAGGGAGAATGG - Intronic
1092702955 12:11253482-11253504 AGGTCAGAGAGAAGGAACAAAGG + Intergenic
1092791097 12:12071668-12071690 AGGGGAGAGAGGAGAGAGAAGGG - Intronic
1092798210 12:12135354-12135376 AAGTGGGAGAGAAGAGAAAAAGG + Intronic
1092821232 12:12355551-12355573 AGGTGAGAGAGGAGGTAAAAGGG - Intergenic
1093491658 12:19711532-19711554 AGGTTGGAGAGGAGGATGAAGGG + Intronic
1093801883 12:23383427-23383449 AGGGTGGAAGGGAGGGACAAGGG + Intergenic
1093957077 12:25232727-25232749 AGCTGGGAGTGGGGGGACTATGG - Intronic
1094131309 12:27078749-27078771 AGGTGGCAGGGCAGGGACTAGGG + Intergenic
1094180771 12:27590594-27590616 AGGTGGCAGAGCAGGGACTAGGG + Intronic
1094473295 12:30822929-30822951 AGGCGGGAGATCAGGGACGAAGG - Intergenic
1094695524 12:32814464-32814486 GGGAGGGAGAGCAGGGAGAACGG - Intronic
1095962542 12:47844581-47844603 AGGTTGGACAGGAGAGAGAATGG + Exonic
1096205915 12:49721773-49721795 TGGTGGGAGGGAAGGGGCAAGGG - Intronic
1096205928 12:49721823-49721845 GGGTGGGAGGGAAGGGGCAAGGG - Intronic
1096258521 12:50077059-50077081 AGGTGGGAGAGGGGAGCAAATGG + Intronic
1096309225 12:50505379-50505401 GGGTGGGAGAGGAGGGAAAACGG - Intronic
1096362418 12:50999525-50999547 ACTTGAGGGAGGAGGGACAATGG + Intronic
1096478780 12:51924333-51924355 TGGTGGGAGAGTGGGGAGAAGGG + Intergenic
1096489429 12:52005836-52005858 AGGAGGGAGGGGACAGACAAGGG + Intergenic
1096793665 12:54060713-54060735 AGGTGAGATAGGAGGAAGAAAGG - Intergenic
1096793889 12:54061967-54061989 AGGAGGGGGAGGAGGGGGAAAGG - Intergenic
1096846863 12:54412190-54412212 AGGTAGGAGAGGACAGAGAATGG - Intronic
1097221072 12:57451488-57451510 ATGTGGGGGAGGACGGGCAAAGG - Intergenic
1097298323 12:57991198-57991220 AGGTGGGAGAGGAAAGAGCATGG + Intergenic
1097302176 12:58030615-58030637 AGCTGGGAGAGAGGGGAGAAAGG + Intergenic
1097387586 12:58967590-58967612 AGGTGGGAGATGATTGATAATGG + Intergenic
1097878553 12:64666720-64666742 AGGTGGGACATGTGGGACAGTGG - Intronic
1098285383 12:68901867-68901889 AGGGGAGAGAGGAGAGAGAAGGG + Intronic
1098523534 12:71460749-71460771 ATGTAGGAGAGGAGGAAGAATGG - Intronic
1099034538 12:77569374-77569396 GGGAGGGAGAGGAGGGAGATGGG - Intergenic
1099693938 12:85994540-85994562 AGGTGGGGGAGGAGTGTGAATGG - Intronic
1100098991 12:91079338-91079360 AGGAGGGGGAGGAGGCATAATGG + Intergenic
1100435733 12:94569880-94569902 TGGCGGGAGTGGTGGGACAAGGG + Exonic
1100598710 12:96093706-96093728 AGCGGGGAGGGGAGGGACACAGG + Intergenic
1100628448 12:96361342-96361364 AAGTAAAAGAGGAGGGACAAAGG - Intronic
1101054960 12:100903015-100903037 AAGTGGCAGAAGAGGGAAAAGGG - Intronic
1101293363 12:103394861-103394883 AGGTGGGAGATATGGTACAAAGG + Intronic
1101661329 12:106768093-106768115 GGGTGGGGGAGGAGGGAGCACGG + Intronic
1101683047 12:106987603-106987625 AGGAGGGAGAGAAAGGAGAATGG - Intergenic
1101709578 12:107252707-107252729 AGGGTGGGGAGGAGGGAGAAGGG - Intergenic
1101728932 12:107410684-107410706 AGGAGAAAGAGAAGGGACAAGGG + Intronic
1101932966 12:109029940-109029962 AGATGGGAGAGGAGGGATTATGG - Intronic
1101942591 12:109111113-109111135 AGGGCGGGGAGGAGGGGCAAGGG - Intergenic
1101967041 12:109288633-109288655 AAAGGGGAGAGGAGGCACAAAGG - Intronic
1102243652 12:111341614-111341636 AGGAGAGTGAGGAGGGAGAAAGG + Intronic
1102394380 12:112574630-112574652 GGGTGGTGGAGGAGGGAGAAGGG + Intronic
1102394451 12:112574834-112574856 GGGTGGTGGAGGAGGGAGAAGGG + Intronic
1102453111 12:113056114-113056136 AGGTGAGAGGGGTGGGACCAGGG - Intergenic
1102460134 12:113094946-113094968 AGGTGGGTTGGGCGGGACAATGG + Exonic
1102474483 12:113179835-113179857 AGATGTGACAGGTGGGACAAGGG + Intronic
1102549633 12:113682443-113682465 AGGAGGAAAAGGAGTGACAAAGG - Intergenic
1102717425 12:114986386-114986408 AGGGAGGAAAGGAGGGAAAAAGG - Intergenic
1102809342 12:115810564-115810586 GGGTGGGAGAGAAGGGAAATGGG + Intergenic
1102857999 12:116311632-116311654 AGGTAGAACAGGAGGGCCAAGGG + Intergenic
1103005643 12:117418121-117418143 AGGAGGGAGAGGAGGGGGAAAGG + Intronic
1103005657 12:117418160-117418182 AGGAGGGAGAGGAGGGGGAGAGG + Intronic
1103367063 12:120390990-120391012 AGGCGGGAGAGCAGGTGCAAAGG - Intergenic
1103522587 12:121546336-121546358 AGATGGGAGAGAAGTGAAAAGGG - Intronic
1103815329 12:123650370-123650392 TGGTGGGAGAGGGAGGGCAAGGG + Intronic
1103879806 12:124157389-124157411 AGGTGGGAGTGGAGGGAACGAGG + Intronic
1103930288 12:124446525-124446547 AGGTGGAACAGGAGGTGCAAAGG - Intronic
1104148655 12:126060326-126060348 AGGAGGCTGAGGAGGGAGAATGG - Intergenic
1104569045 12:129909163-129909185 TGGTGGGAGGGGAGGTACAGGGG + Intergenic
1104569464 12:129912324-129912346 CGGTGGGAGAGGAGAGACCAGGG + Intergenic
1104596621 12:130124607-130124629 ATGTGGGAGAGGACGGCCAGGGG + Intergenic
1104781250 12:131421997-131422019 ACGTGGGAGAGGAGGGTAAGGGG - Intergenic
1104781276 12:131422094-131422116 AGGTGGAGGAGGAGGGAGGAGGG - Intergenic
1104950432 12:132437504-132437526 AGGAGGGAGGGGAGAGACGAAGG + Intergenic
1105544117 13:21339435-21339457 GGGAGGGTGAGGAGGGAAAATGG - Intergenic
1105565853 13:21547201-21547223 AGGTTCAAGGGGAGGGACAAAGG + Intronic
1105764590 13:23546918-23546940 AGGGGAGAGAGGAGGGAGGAAGG - Intergenic
1106075488 13:26457352-26457374 AAGTGGGAGAGGAGGGGACAAGG - Intergenic
1106096204 13:26646526-26646548 GGGTGGGAGGGGAGTGACACAGG - Intronic
1106310404 13:28549205-28549227 AGGTGAGACAGGAGGGAACAAGG + Intergenic
1106795713 13:33202820-33202842 GGGTGGGGCAGGAGGGACACGGG + Intronic
1107367130 13:39693272-39693294 AAGAGGGAAAGGAGGGAGAAAGG - Intronic
1107456870 13:40563305-40563327 AGGTGGTAGAAGAGAGAAAATGG + Intronic
1108044995 13:46375077-46375099 AGGTGGGAGTAGGGGGAGAATGG - Intronic
1108673339 13:52713917-52713939 AGGTGGGGGAGGAAGGAGATTGG - Intronic
1109747657 13:66647666-66647688 AGGTGGGAGAGAAGAGTAAAGGG + Intronic
1110176712 13:72565413-72565435 AGGTGGGAGAGAAGGGAGAGAGG - Intergenic
1110528717 13:76571538-76571560 AGGTGGGGGAAAAGGGAAAAGGG - Intergenic
1110702123 13:78561173-78561195 AGGTGGGAGAGTAGAGAGACAGG + Intergenic
1111708149 13:91777102-91777124 TGGTGGGGGAGGAGGAAGAAAGG - Intronic
1111732469 13:92094413-92094435 AGGTGGCTGAGGCGGGAAAATGG + Intronic
1111889297 13:94061702-94061724 AGGTTAGAGAGGAGGGATAATGG - Intronic
1112407293 13:99132485-99132507 AGGAGGGAGAGCAGGCACAGAGG + Intergenic
1112500773 13:99941346-99941368 AGCTGGAAGAGGAGGGAGACAGG - Intergenic
1112759696 13:102680473-102680495 AGCTGGGGGTGGAGGGAGAAAGG - Intergenic
1113122280 13:106936241-106936263 AGGAGGGAGAGGAGGAGAAAAGG + Intergenic
1113257971 13:108528582-108528604 AGAGGGGAGAGGAGGGGAAAGGG - Intergenic
1113438216 13:110308955-110308977 AGTAAGGAGAGGAGGGACAGCGG - Intronic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113595679 13:111530227-111530249 GGGTGGGAGTGGAGGCAGAAAGG + Intergenic
1113646134 13:111997951-111997973 AGATGGGAGAGGAGGATGAAGGG - Intergenic
1113930254 13:113964602-113964624 AGGAGGGAGAGTAGGGAGGAAGG - Intergenic
1114450066 14:22819610-22819632 AGGTGGGAGAGGAGGGACAATGG - Intronic
1114479426 14:23023158-23023180 ATGTGGGGGAGGAGGGAGGAAGG - Intronic
1114484289 14:23053871-23053893 AGGTGGCACTGGAGGGACAGTGG + Intronic
1114556727 14:23566505-23566527 AGATGGGAGAGTAGGGACCTTGG - Intronic
1114613783 14:24057878-24057900 AGGTGGGAGAGGAGGGGGAAGGG + Exonic
1114661074 14:24345214-24345236 AGGTGGGATAGGAGAGCTAAAGG - Intergenic
1115348313 14:32366100-32366122 TGGGGGGAGGGTAGGGACAATGG - Intronic
1115498289 14:34027457-34027479 AGGGAGGAGAGGAGGAAGAAGGG + Intronic
1115902989 14:38174868-38174890 ATCGGGGAAAGGAGGGACAAAGG - Intergenic
1116584653 14:46687211-46687233 AGTTGGGTGAGGGGTGACAAAGG + Intergenic
1116674897 14:47893424-47893446 AGATGGGGGAGGAAGGAAAAGGG + Intergenic
1116850819 14:49907140-49907162 AGGTAGGGGATGAGGCACAAGGG + Intergenic
1117053548 14:51886876-51886898 AGGTGGAATAGGATGGAGAATGG + Intronic
1117196265 14:53342833-53342855 AAATGGGAGAGGAGAGACACTGG - Intergenic
1117260028 14:54022758-54022780 AGGTGGGACAGGATGGCTAAAGG + Intergenic
1117317636 14:54589165-54589187 AGGTGGGACAAGAGTTACAATGG + Intronic
1117731147 14:58723188-58723210 AGGGGAGAGAGGAGAGATAAAGG - Intergenic
1118701617 14:68439099-68439121 AGTTTGGAGAGGAGGGATGAAGG + Intronic
1118986719 14:70761915-70761937 AGGTTTGGGAGGAGGGAGAATGG - Intronic
1119163411 14:72471778-72471800 AGGTGGGAGAGTAGGTAGGATGG + Intronic
1119188677 14:72663738-72663760 GGGAGGGAGAAGAGGGAGAATGG + Intronic
1119268955 14:73284300-73284322 AGGTGGGAGAGGATGGGGATGGG + Exonic
1119294362 14:73521048-73521070 GGGTGAGAAAGGAGGGAAAAGGG + Intronic
1119372229 14:74156771-74156793 AGATGGGAGAGGTTGGTCAATGG - Intronic
1119400782 14:74360765-74360787 ATGTGGGCCAGGAGAGACAATGG - Intergenic
1120018545 14:79501842-79501864 ATGTCGGAGAGGAAGGACAGAGG + Intronic
1121178271 14:91907230-91907252 AAGGAGGAGAGAAGGGACAAGGG - Intronic
1121227782 14:92334027-92334049 AAGTGGGTGAGGAGGTGCAATGG + Intronic
1121420640 14:93810992-93811014 AGGAGGCAGAGGATGGACACAGG + Intergenic
1121629968 14:95414647-95414669 GGGAAGGAGAGGAGGGAGAAAGG - Intronic
1122019818 14:98828375-98828397 AGATGGGAGAGTAAGGACAAAGG + Intergenic
1122354595 14:101115243-101115265 AGGAGGGACAGCGGGGACAAAGG - Intergenic
1122637704 14:103138175-103138197 AGGAGGGAGACGAGGGCCAGGGG + Intergenic
1122772601 14:104104016-104104038 AGGTGGGAGAGGAGCCAAGAAGG - Intronic
1122839151 14:104446343-104446365 AGGCAGGAGTGGATGGACAATGG - Intergenic
1122915113 14:104854985-104855007 AGGGGGGAGTGGAGGGTGAATGG + Intergenic
1122938442 14:104970557-104970579 AGCAGGCAGAGGCGGGACAATGG - Intronic
1123457028 15:20435633-20435655 TGGTGGGTGGGGAGGGAAAAAGG - Intergenic
1123661034 15:22564726-22564748 TGGTGGGTGGGGAGGGAAAAAGG + Intergenic
1124100822 15:26691045-26691067 GGGAGGGAGAGGAGGGAATAAGG - Intronic
1124263182 15:28210786-28210808 TGGTGGGTGGGGAGGGAAAAAGG - Intronic
1124314835 15:28658960-28658982 TGGTGGGTGGGGAGGGAAAAAGG + Intergenic
1124647664 15:31450409-31450431 AGGGGGAAGGGGAGGGAGAAGGG + Intergenic
1124950491 15:34314782-34314804 AGGAGTGAGAGAAGGAACAAAGG - Intronic
1124953568 15:34344911-34344933 AGGAGGGTGAGGCAGGACAATGG + Intronic
1126783105 15:52155184-52155206 AGGTAGGTGAGGAGGGAAGAGGG + Intronic
1126799270 15:52285458-52285480 AGGAGGGAGAGGAGGGAGACGGG - Intronic
1127346830 15:58109502-58109524 ACGTGTGGGAGGAGGTACAATGG + Intronic
1128285387 15:66432342-66432364 AGGAGGTAGAGGAGGGAGAAAGG + Intronic
1128626143 15:69206498-69206520 AAATGGAAGAGAAGGGACAAAGG - Intronic
1128637793 15:69314301-69314323 AGGAGGGACAGGAGGGAGAAGGG - Intronic
1129330725 15:74825995-74826017 AGCTGGGCCAGGAGGGACACTGG - Intergenic
1129442127 15:75588965-75588987 AGGGGGGAGAGGAGGAAAAGGGG + Intergenic
1129512856 15:76137682-76137704 GGGTTGGAGAGGAGGAACAATGG - Intronic
1129665316 15:77576332-77576354 AGGGGGAAGAGGGGGGACAAAGG + Intergenic
1129919948 15:79311443-79311465 ACCTGGGAGTGGAGGGAGAAGGG - Intronic
1130330754 15:82920501-82920523 AGCTGGGAAAGGTGGGGCAATGG - Intronic
1130549088 15:84878376-84878398 TGGTGGGATTTGAGGGACAACGG + Intergenic
1130903244 15:88223006-88223028 AGGAGGGAGAGGAAGGAGATGGG + Intronic
1131014154 15:89043513-89043535 AGGAGGAAGAGGAGGGAGGAGGG + Intergenic
1131141510 15:89980234-89980256 GGGTGGGAGAAGAAGCACAAGGG - Intergenic
1131158270 15:90088317-90088339 AGCTGGGAGAGGAGGGGCCCAGG + Intronic
1131287774 15:91076055-91076077 AGGCAGAAGAGGAAGGACAAAGG - Intergenic
1131330395 15:91493212-91493234 AGGGGGGAGAGGAGGAGAAAAGG + Intergenic
1131399111 15:92110466-92110488 AGGTGGGCGTGGAGGGAACAGGG - Intronic
1131579225 15:93625646-93625668 AAGTAGGAGAGGAGGTAGAAGGG + Intergenic
1132184041 15:99788377-99788399 TGGAGGGAGGGGAGGGACAGAGG - Intergenic
1132311379 15:100860523-100860545 AGCTGGGGGTGGAGGGACAGAGG - Intergenic
1132452018 15:101973726-101973748 AGGTGGGAGGGGTGGGACAGAGG + Intergenic
1132454877 16:16895-16917 AGGTGGGAGGGGCGGGACAGAGG - Exonic
1132664056 16:1073627-1073649 GGGTGGGGGAGGAGGGCCAAGGG - Intergenic
1132789147 16:1675428-1675450 AGGAGGGAGAGTAGGTCCAAGGG - Exonic
1133116054 16:3578603-3578625 AGGTGGGAGCCAAGGGACAGGGG + Intergenic
1133285491 16:4688769-4688791 AGGTGGGAGCAGAGGGAGGAGGG - Intronic
1133305220 16:4804195-4804217 AAGAGGGAGAGGAGGGAGGATGG + Exonic
1133341144 16:5037025-5037047 TGGTGGGAGAGGAGGGCCGTGGG + Intronic
1133469253 16:6058325-6058347 AGGAAGGAGAGGAGGGAGGAAGG - Intronic
1133931191 16:10233369-10233391 AGGAGAGAAAGGAGGGAAAAGGG - Intergenic
1134031908 16:10998807-10998829 AGTGGCGAGAGGAGGGACAGGGG + Intronic
1134060247 16:11195130-11195152 AGGAAGGAGAGGAGGCAGAAGGG - Intergenic
1134125572 16:11613666-11613688 AGGTGGGAGAGGAGCAGGAAAGG + Intronic
1134286791 16:12868650-12868672 AGGCAGGAAGGGAGGGACAAAGG - Intergenic
1134449285 16:14353929-14353951 AGTGGGGAGAGGAGGGGGAAAGG + Intergenic
1134523306 16:14928075-14928097 AGGGGGGAGAGGAGAGGGAAGGG - Intronic
1135050015 16:19185145-19185167 AGGAGGGGAAGGAGGGAGAAAGG - Intronic
1135061075 16:19271938-19271960 AGGTGGGAAAGGAGATACACAGG + Intergenic
1135305247 16:21362266-21362288 TGGTGGGAGAGGAGGGTAAGTGG - Intergenic
1135503712 16:23018429-23018451 AGATGGGAGAGGAGAGATCAAGG - Intergenic
1135777375 16:25268693-25268715 AAGTTGAAGAGGAGGAACAATGG + Intergenic
1135868608 16:26128066-26128088 AGGAGGAAGAGGAGGAGCAAAGG - Intronic
1136037843 16:27554013-27554035 GGGAGGGAGAGGAGAGAGAAAGG + Intronic
1136301992 16:29341431-29341453 TGGTGGGAGAGGAGGGTAAGTGG - Intergenic
1136363738 16:29798763-29798785 GGTTGGGAGAGGAGCAACAAAGG + Intronic
1136566658 16:31074524-31074546 AGGTGGGAGGGAAGGGAAAGAGG - Exonic
1136590159 16:31213836-31213858 AGGTGGGAGTGGGGGGAGAAAGG + Intergenic
1136930116 16:34410920-34410942 ATGTGGCAGAGGAGGGAGAGGGG - Intergenic
1136974458 16:35000885-35000907 ATGTGGCAGAGGAGGGAGAGGGG + Intergenic
1137774033 16:51040943-51040965 AGGAGGGAGAGGAGGGAAAGAGG + Intergenic
1137977309 16:53042498-53042520 AGGAGGGAGAGGAGGGGGGAAGG - Intergenic
1138352216 16:56352105-56352127 AGGGGAGAGAGGAGGCGCAATGG - Intronic
1138358575 16:56406078-56406100 AGGGGGGAGAGGGGGGAGAGGGG + Intronic
1138365359 16:56471635-56471657 AGTTAGGAGAGCAGAGACAAGGG + Intronic
1138583966 16:57958634-57958656 AGGGTGGAGAGGGGGGAGAATGG - Intronic
1138742711 16:59329399-59329421 GGGCAGGAGAGGAGGGTCAAGGG + Intergenic
1139165757 16:64563339-64563361 AGGTGGAGGAGGAGGGAAGAAGG + Intergenic
1139195733 16:64916816-64916838 ATCTGGAAGTGGAGGGACAAAGG - Intergenic
1139290160 16:65850662-65850684 AGGAGGGAGAGAGGGGAAAAAGG + Intergenic
1139709308 16:68763627-68763649 AAGTGGGGGAGGAGGGCCGAGGG - Intronic
1139801490 16:69526597-69526619 AGGTGAAAGAGGAGGGATTAAGG - Intergenic
1139842559 16:69893220-69893242 AGGTGTGAGAAGAGTGACAGAGG - Intronic
1139933420 16:70548631-70548653 AGGTGGGAAAGGGGGAACATAGG + Intronic
1139961907 16:70722721-70722743 AGGAGGCAGAGGATGGAAAATGG + Intronic
1139975072 16:70803399-70803421 AGGTCAGAGAAGAGGAACAAGGG - Intergenic
1140104435 16:71946812-71946834 AGGGGGAGGAGGAGGGAGAAGGG + Intronic
1140237238 16:73170704-73170726 AGGTGGGAAAAGCTGGACAAAGG + Intergenic
1140844117 16:78870565-78870587 AGGGGTGAGAAGAGAGACAAGGG - Intronic
1141028451 16:80568786-80568808 AGGTGGGAGAGGTGGGAGTGTGG - Intergenic
1141104559 16:81222757-81222779 ACGTGATAGAGGAGGGGCAATGG - Intergenic
1141119378 16:81340049-81340071 AGGTGGCAGAGGATACACAATGG - Intronic
1141171665 16:81695634-81695656 AGGAGGGAGAGGATGGAGAGCGG - Intronic
1141478384 16:84289336-84289358 AGATGGGAGAGGGGGGAAAGTGG - Intergenic
1141671247 16:85492876-85492898 AGGTGACAGAGCAGGGACAGAGG + Intergenic
1141713950 16:85716407-85716429 AGGAGGGAGAAGAGGGAGAGAGG + Intronic
1141828260 16:86495712-86495734 AGGTGGCAGAGGAGAGAAAGTGG + Intergenic
1141845109 16:86603342-86603364 AGGAAGGAGAGGAGTGAGAAGGG - Intergenic
1141884087 16:86879933-86879955 GGGTGGGAGTTGAGGGACAGAGG - Intergenic
1141945381 16:87305690-87305712 AGGTGGGGGATGGGGGACAGTGG - Intronic
1142135037 16:88448011-88448033 AGGAGGGAGAGGAGAGAGGAAGG + Intergenic
1142561311 17:811134-811156 AGGTGGCACAGGAGGGAAGAAGG + Intronic
1142942734 17:3396359-3396381 AGGAGGGAGAAGAGGTAAAATGG + Intergenic
1143166110 17:4897974-4897996 GGGTGGGGGGGGAGGGAGAAGGG - Exonic
1143195490 17:5073220-5073242 AGATAGAAGAGAAGGGACAAGGG + Intergenic
1144041385 17:11414093-11414115 AGGAGGGAAAGGAGGAGCAATGG - Intronic
1144190139 17:12838018-12838040 AGATGGGAGGGGAGGGAAACTGG - Intronic
1144278976 17:13705454-13705476 AGCTGGGAGAGGAAGGAAATGGG - Intergenic
1144396868 17:14852830-14852852 AAGTGGAGGAGGGGGGACAAGGG + Intergenic
1144610979 17:16715063-16715085 AGGTTTGAGAGGAGGGATAGTGG - Intronic
1144901760 17:18600302-18600324 AGGTTTGAGAGGAGGGATAGTGG + Intergenic
1144929313 17:18845758-18845780 AGGTTTGAGAGGAGGGATAGTGG - Intronic
1145130744 17:20345770-20345792 AGGTTTGAGAGGAGGGATAGTGG - Intergenic
1145721633 17:27078492-27078514 AGGAGGGAGAGGAGGGGTCAGGG - Intergenic
1145775657 17:27526499-27526521 AGATGGCAGAGGAGGAACACAGG - Intronic
1146174249 17:30654789-30654811 GGGCGGGAGTTGAGGGACAAGGG + Intergenic
1146347704 17:32070816-32070838 GGGCGGGAGTTGAGGGACAAGGG + Intergenic
1146422616 17:32702562-32702584 TGGGGGGCGAGGAGGGACAAAGG - Intronic
1146453710 17:32993846-32993868 CGCCGGGAGAGGAGGGACAACGG + Intronic
1147139207 17:38452150-38452172 AGGTGGGAGGGGAGGGGGAAGGG - Intronic
1147169814 17:38611399-38611421 AGTTGGGGGAGGAGGGAGACAGG + Intergenic
1147177240 17:38663560-38663582 AGGGTGGAGAGGAGGGAGAGAGG - Intergenic
1147566406 17:41538968-41538990 AAGGGGGAGATGAGGGAGAACGG + Intergenic
1147765288 17:42830980-42831002 AGGTGGGAGAGAAGGAATACTGG + Intronic
1148239068 17:45988162-45988184 CAATGGGAGAGGAGGGACACAGG - Intronic
1148676557 17:49448886-49448908 GGCTGGGAGAGAAGGGAGAAGGG + Intronic
1148698936 17:49576722-49576744 AGGCGGGAGGGGAGGGACGCGGG - Intronic
1148798065 17:50206944-50206966 TGGGTGGAGAGGTGGGACAACGG - Intergenic
1149755549 17:59182704-59182726 AGGTGGGATAGGATTGACTAAGG - Intronic
1149891272 17:60392175-60392197 AGGAGAGAGAGGAGAGAGAAGGG - Intronic
1150542031 17:66111723-66111745 AGGAGGGAGAAGAGAGAAAAGGG + Intronic
1150603042 17:66667126-66667148 AGGTGGCAGAGGTGGGGGAAGGG - Intronic
1150984032 17:70175218-70175240 ATGTGGGTGAGAAGGGGCAACGG + Exonic
1151486146 17:74402088-74402110 AGCTGGGAGTGGAGGGGCAAAGG - Intergenic
1151537271 17:74745972-74745994 AGATGGGAGGGGGAGGACAAGGG + Exonic
1151995728 17:77607817-77607839 AGGTGGGAGCGGCTGGACACTGG + Intergenic
1152003445 17:77662020-77662042 AGGAGTGAGAGGAGGGTCAGGGG + Intergenic
1152043074 17:77917555-77917577 AGGAAGGAGAGGAAGGAGAAGGG + Intergenic
1152103649 17:78316682-78316704 AGATGGGGGAGGAGGGAGACAGG - Intergenic
1152104226 17:78319370-78319392 AGGGAGGAGAGAAGGGACTAGGG - Intergenic
1152266232 17:79296652-79296674 AGGAGGAAGAGGAGGGAGATGGG - Intronic
1152550516 17:81027741-81027763 TGGAGGGGGAGGAGGGACACGGG - Intergenic
1152664949 17:81562432-81562454 AGGAGGCAGAGGCTGGACAATGG + Intronic
1152941982 17:83177651-83177673 AGGAGGAAGAGGTGGGAGAACGG - Intergenic
1153040028 18:803713-803735 AGGTGGGAAAGGAGGGTGACTGG + Intronic
1153343876 18:4005625-4005647 AGGAGGGAGAGGATGCAGAAAGG - Intronic
1153410526 18:4787872-4787894 AGTTGGGAGTGGAGGGAGAGTGG + Intergenic
1153574140 18:6504049-6504071 AGGAAGGAAAGGAGGGAAAAAGG + Intergenic
1154353142 18:13603824-13603846 AGCAGGGACAGCAGGGACAAGGG + Intronic
1155085484 18:22453936-22453958 AGGTGGGAGGGGAGGGCAAGTGG + Intergenic
1155947184 18:31868106-31868128 CAGTGGGAGAGAAGGGAAAAAGG + Intronic
1157112580 18:44834862-44834884 AGGAGGGAGAGGGGAGCCAAGGG + Intronic
1157268380 18:46248948-46248970 AGCTGGGAGAGGACTGATAAAGG - Intronic
1157342862 18:46794876-46794898 GGGAGGAAAAGGAGGGACAAAGG - Intergenic
1157483709 18:48072715-48072737 AGGTGGGATTGGAGGAGCAATGG - Intronic
1157604992 18:48920771-48920793 ATGAGGGAGAGGAGGGGCAGGGG + Exonic
1157725253 18:49959032-49959054 AGGTTGGAAAGTAGGGACCATGG - Intronic
1157741478 18:50097106-50097128 AGATAGGGGAGGAAGGACAAGGG - Intronic
1157788567 18:50509033-50509055 AAATGGGGGAGGAGGGAAAAAGG - Intergenic
1157865035 18:51175424-51175446 AGGGGAGGGAGGAGGGAGAAAGG - Exonic
1158391772 18:57050532-57050554 ACAGGGGAGAGCAGGGACAATGG - Intergenic
1158594877 18:58807271-58807293 AGGTGGGTCAGGAGGCAGAAAGG - Intergenic
1158610461 18:58935375-58935397 AGAGGGGAGAGGAGGGAGAGGGG - Intronic
1158610470 18:58935398-58935420 AGGAGGGAGAGGGGGGAGGAGGG - Intronic
1158629809 18:59101996-59102018 AAGAGGGCGAGGAGGGACGAAGG + Intergenic
1159002439 18:62986416-62986438 TGGGGGGAGAGAAAGGACAATGG + Intergenic
1159122790 18:64190268-64190290 AGGAGGCAAAGGAGGGGCAAAGG + Intergenic
1160030587 18:75255156-75255178 AGATGGTAGAGGAGGAAGAAAGG - Intronic
1160048706 18:75411542-75411564 AGATTGCAGAGGAGGGACAGAGG + Intronic
1160362336 18:78294554-78294576 AGGAGGGGGAGGAGGAACGATGG + Intergenic
1160377550 18:78424772-78424794 AGGTAGGAGAGAAGGGCAAAAGG - Intergenic
1160545064 18:79647425-79647447 AGGGGGGAGGGGAGGGGGAAGGG + Intergenic
1160965691 19:1746084-1746106 AGGATGGGGAGGAGGGAGAAGGG + Intergenic
1161206120 19:3042180-3042202 AGGAGGAAACGGAGGGACAAAGG + Intronic
1161237290 19:3204380-3204402 CAGTGGGTAAGGAGGGACAAGGG - Intronic
1161424373 19:4194685-4194707 TGCTGGGGGAGAAGGGACAAGGG + Intronic
1161523417 19:4738573-4738595 AGGTGGGAGAAGAGGGGGGAGGG + Intergenic
1161803497 19:6429341-6429363 AAGAGGGAGAGGAGGGAGAAAGG + Intronic
1161978345 19:7618257-7618279 AAGTGGGGGAGGACAGACAAGGG - Exonic
1162032842 19:7924903-7924925 AGGGGAGGGAGGAGGGACAAGGG + Exonic
1162395669 19:10416989-10417011 AGGTGCGAGAGGAGGGGCTTGGG + Intronic
1162967600 19:14163433-14163455 AGGTAGGAGAGAAGGGGCAGAGG + Intronic
1163453999 19:17395273-17395295 AGGAGGGAGAGAAGGGGCAGGGG - Intergenic
1163740649 19:19009800-19009822 AGATGGGAGAGTAGGGACTGGGG + Intronic
1163779591 19:19239503-19239525 GGGGAGGAGAGGAGGGAGAAGGG - Intronic
1163827840 19:19533531-19533553 AGGAGGGAGAGGAAGGAGAAAGG - Intronic
1163928034 19:20363851-20363873 AGGTGGGAGAGTAGCCACAGAGG - Intergenic
1164123660 19:22290518-22290540 AGGTGGGAGGGGATGGCAAATGG + Intronic
1164249906 19:23467385-23467407 AGGAGGAAGAGGAGAGAAAAAGG - Intergenic
1164292723 19:23881969-23881991 AGGAGGAAGAGGAGGAAGAAAGG + Intergenic
1164474433 19:28564242-28564264 AAGTGGGAGAGGAGGTAGACAGG - Intergenic
1164536037 19:29087287-29087309 AGGTGGGAGGAGAGAGACCAGGG + Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1164810901 19:31154991-31155013 AGGTGGGAGAACAGAGGCAAGGG - Intergenic
1164842442 19:31402663-31402685 ATGTGGGAGAGCAAGGACAGCGG + Intergenic
1164866849 19:31611517-31611539 AGGAGAGAGAGGAGGGGGAAAGG + Intergenic
1164866855 19:31611537-31611559 AGGAGAGAGAGGAGGGGGAAAGG + Intergenic
1165359899 19:35329747-35329769 TGCTGGCAGAGGAGGGACAATGG + Intronic
1165392883 19:35548444-35548466 TGGTGGAGGAGGAGGGGCAATGG - Intergenic
1165763451 19:38336010-38336032 AGCTGGGAGAGGAGGGAAAGAGG + Intronic
1165763462 19:38336047-38336069 AGCTGGCAGAGGAGGGAAAGGGG + Intronic
1165847416 19:38827114-38827136 GGGAGGGAGGGGAGGGAGAAAGG + Intronic
1165855994 19:38879564-38879586 AGGTGGGAGCGGGGGCACGAAGG - Intronic
1165940112 19:39410621-39410643 AGAAGGGAGAGGAGGGAAAGGGG - Intergenic
1166310963 19:41962360-41962382 ATGTGGGAGAGGAGGGCCTGAGG + Intergenic
1166347983 19:42178143-42178165 TGGGGGGAGAGGAGGGAGGAGGG + Intronic
1166656033 19:44612705-44612727 AAGTCGGAGAGGTGGGACTAAGG + Intergenic
1166778434 19:45326540-45326562 AGTTGGGTCAGGAGGGACAGTGG - Intergenic
1166931945 19:46306383-46306405 AGGTGGGAGAAGAGGAATAGGGG + Intronic
1167000987 19:46745913-46745935 AGGTGGGAGTGGAGGGACCGGGG - Intronic
1167011853 19:46813760-46813782 AGGAGGGATAGGAGGGAAAGAGG - Intergenic
1167140637 19:47648246-47648268 AGGCGGGAGAGGAGGTGAAAGGG - Intronic
1167436520 19:49481563-49481585 AGGTGGGCCAGGAGGGAAGAAGG + Intronic
1167440634 19:49506772-49506794 AGGGTGGAGAGGAGGGGCAGCGG + Intergenic
1167531905 19:50023046-50023068 AGATGGGAGAGCAGGTGCAAAGG - Intronic
1167622890 19:50568712-50568734 AGGGGAGAGAGGAGGGAAAGGGG + Intergenic
1167874386 19:52399066-52399088 AGGTGGGAGAGAAGGAATAGAGG + Intronic
1167874592 19:52401121-52401143 GGGTGGGTGAAGAGGGAAAATGG - Intronic
1167915005 19:52733762-52733784 AGGTGGAAGAGAAGGAATAAAGG - Intronic
1168162537 19:54521139-54521161 ACGTGGGTGAGGAGGGACTCGGG + Intergenic
1168165125 19:54541953-54541975 AAGTGGGAGGGGAGGCACACTGG + Intronic
1168251592 19:55145369-55145391 AGGAGGGAGAGGAGGGAGGAGGG + Intronic
1168261854 19:55199701-55199723 AGGGAGGAGGGGAGGGAGAAAGG + Intronic
1168288701 19:55346917-55346939 GGCAGGGAGAGGAGGAACAAAGG - Intronic
1168389338 19:55993434-55993456 AGGGGGGAGAGGAGGGGGAGAGG - Intergenic
925188025 2:1862885-1862907 AGATGGGAGAAGAAGGAGAAAGG + Intronic
925777633 2:7350165-7350187 CTGAGGGAGATGAGGGACAAGGG + Intergenic
926073614 2:9922412-9922434 AGGAGGCAGAGCAGGTACAAAGG - Intronic
926087760 2:10030686-10030708 AGAAGGGGGAGGAGGGAAAAGGG + Intergenic
927009081 2:18882874-18882896 AGGAGGGTGAGGCGGGAGAATGG - Intergenic
927422420 2:22947493-22947515 GGCTGGGAGAGGAGGGAACAGGG + Intergenic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927608931 2:24516692-24516714 ACATGGGAGAGGAGAGAAAAGGG - Intronic
927666964 2:25039477-25039499 AGGTGTGGGAGGAGGGGCACAGG - Intergenic
927704865 2:25290822-25290844 AGGCAGGGGAGGAGGGAGAATGG - Intronic
927809569 2:26173687-26173709 AGGTGAGAGGCCAGGGACAAAGG - Intronic
927951680 2:27174466-27174488 CAGTGGGAGAGGAGGGGTAAGGG - Intergenic
928081341 2:28315094-28315116 AGAGGGGAGAGGAGGGGAAAAGG + Intronic
928475367 2:31621265-31621287 AGATGGGAGATGAGGAGCAATGG - Intergenic
928931880 2:36633315-36633337 GGGAGGGAGGGGAGGGAGAAAGG - Intronic
928958664 2:36898878-36898900 AGGAGAGAGAGAAGGGAGAAGGG + Intronic
929216924 2:39424345-39424367 AGGTGGGAGGGGATGGAGGAAGG + Intronic
929298106 2:40271230-40271252 AGGTGGGAGAGGAGTGGGAGGGG - Intronic
929434988 2:41921914-41921936 AGGAGGCAGAGAAGGGACTAAGG + Intergenic
929444475 2:41991890-41991912 AAGGGGGAAAGGAGGGAGAAGGG + Intergenic
929536231 2:42786090-42786112 AGGGAAGGGAGGAGGGACAAAGG + Intronic
929584632 2:43106023-43106045 AGGAGGAGGAGGAGGGACACAGG - Intergenic
929687538 2:44047519-44047541 AGAGGAGAGAGGATGGACAAAGG - Intergenic
929836455 2:45405379-45405401 AGTTGTAAAAGGAGGGACAAAGG + Intronic
929939700 2:46324169-46324191 AGGAGGGTGAGGAAGGAGAATGG - Intronic
930752172 2:54944981-54945003 ATGGGGGAGGGGAGGGAGAAAGG - Intronic
930752211 2:54945085-54945107 GAGTGGGAGAGGAGGGAGAGAGG - Intronic
930793270 2:55357377-55357399 AGGAGAGAGAGGAGGGAGAGAGG - Intronic
931223141 2:60306306-60306328 GGGTGGGAGTGGAGGGAGGAAGG - Intergenic
931759048 2:65400480-65400502 AGATGGGGGATGAGGGCCAACGG - Intronic
931987576 2:67756451-67756473 GGGTGTGAGAGGATGGAAAAAGG - Intergenic
932022724 2:68104053-68104075 AGGTGGGAGTGGAAGGAAGAAGG + Intronic
932103724 2:68924276-68924298 AGGTGGGATGGGAGGGATAGGGG - Intergenic
932430368 2:71670538-71670560 AGGTGGGAGTGGAGAGAGGAGGG - Intronic
932480068 2:72033726-72033748 CGGCTGGAGAGGAGGGAGAAGGG - Intergenic
932534708 2:72580936-72580958 AGGTGGGAGAGTCAGTACAATGG - Intronic
932621294 2:73266064-73266086 ATGGGGGAGAGGAGAGAGAAGGG + Intronic
932763554 2:74456163-74456185 AGGAGGAAGAGGAGGAACAGAGG + Exonic
933498793 2:83086163-83086185 AGGGGGGCGGGGAGGGACAGAGG - Intergenic
933821795 2:86119459-86119481 AGGAGGCTGAGGAGGGAGAATGG - Intronic
934553371 2:95275389-95275411 AGTGGGGAGAGGAGGGACACAGG + Intronic
934560893 2:95312792-95312814 TGGTGGGAGCTGAGGGACGAGGG + Intronic
934653198 2:96104057-96104079 AGGGGGGAGAGGAAGAAGAAGGG - Intergenic
934699239 2:96425902-96425924 AGGAGGGAGAAGAGGGAAAGAGG + Intergenic
934851888 2:97707011-97707033 AGGGAGGAGGGCAGGGACAATGG + Intergenic
935186804 2:100741996-100742018 AGCTGGGGGAAGAGGGACATAGG + Intergenic
935373962 2:102376682-102376704 TGGTGGGAGGGGAGGGATGATGG + Intronic
935560505 2:104554205-104554227 AAATGGGAGGGGAAGGACAAAGG + Intergenic
935721503 2:105983290-105983312 AGGAGAGTCAGGAGGGACAAAGG + Intergenic
936073956 2:109389953-109389975 AGGTGGGTGAGGAGGAACAAGGG - Intronic
936232111 2:110712161-110712183 AGCAGGGTGAGGAGGGAAAATGG - Intergenic
936250696 2:110866253-110866275 AGGCAGGAGAGGAGGGGCAGAGG + Intronic
936280607 2:111136418-111136440 AGTTGGGAGAGGAAGGACCTGGG + Intronic
936379397 2:111970718-111970740 AGTAGGGGGAGGAAGGACAAGGG - Intronic
936568233 2:113596202-113596224 AGGTGGGAGGGGTGGGACAGAGG + Intergenic
937001335 2:118470437-118470459 AGGAGGGAGAGGGAGGAAAAGGG - Intergenic
937066545 2:119022354-119022376 AGGTGGGAGCGGAGGGCCTGGGG - Intergenic
937239888 2:120453218-120453240 GGGTGGGAGTGGAGGGCGAAGGG - Intergenic
937736248 2:125294361-125294383 AGCTGGGAGGGAAGGGAAAATGG - Intergenic
938267189 2:129936442-129936464 AGAAGGGACAGGAGGGACAGGGG + Intergenic
938342496 2:130544791-130544813 AGGTGGGAAAGGAGGAGCTAGGG - Intronic
938347336 2:130575918-130575940 AGGTGGGAAAGGAGGAGCTAGGG + Intronic
938572073 2:132570130-132570152 AGCTGGGTGGGGAGGGCCAAGGG - Intronic
939884148 2:147662816-147662838 AGGAGGAAGAGGAGGAGCAATGG - Intergenic
940101657 2:150046908-150046930 AGATGGGAAAGGATGGAGAAAGG + Intergenic
940852215 2:158699176-158699198 AGGAGGGGGAGGAGGGAGGAGGG + Intergenic
941592747 2:167440236-167440258 AGGAGGGTGAGGCGGGAGAATGG + Intergenic
941673800 2:168322601-168322623 AGGTGGGTGGGGAGGGTGAAAGG + Intergenic
941687475 2:168461914-168461936 AGGTGGCAGCAGAGGGAAAATGG + Intronic
942118199 2:172749485-172749507 AGCTGGGACAGCTGGGACAAAGG + Intronic
942198987 2:173552108-173552130 AGCTGGGGGAGAAGGGAGAATGG + Intergenic
942299379 2:174547328-174547350 AGGAGGAGGAGGAGGGAGAAAGG - Intergenic
942450134 2:176104077-176104099 AGCTGGGAGAGGCGGGTGAAGGG - Intergenic
942468895 2:176239091-176239113 AGGTGGGAGCAAAGGGAAAATGG - Intergenic
943218293 2:185068561-185068583 AGGTGAGAGTGAAGGGAAAATGG + Intergenic
943255022 2:185583721-185583743 AGTTGGGAGAGGGGTGACATGGG - Intergenic
943694434 2:190909464-190909486 AAGTGGGGGAGGGGGGAGAAGGG - Intronic
944150489 2:196553030-196553052 GGGTGGGCGAGTAGGGCCAAAGG + Intronic
944284706 2:197935882-197935904 AGGTGGGAGATGTTGGTCAAGGG - Intronic
944552275 2:200855518-200855540 AGGAGGCTGAGGTGGGACAATGG + Intronic
945027909 2:205637047-205637069 AGGAGGGAGGGGAGGGAGAGGGG - Intergenic
945028394 2:205641507-205641529 AGGTGGGAGAGGGGGGAGTCCGG - Intergenic
945048561 2:205802388-205802410 AGGGGTGAGAGGAGGAAAAAAGG - Intergenic
945118166 2:206429865-206429887 AGGGGGGCGCGGAGGGCCAAGGG + Intergenic
945199507 2:207267063-207267085 AAGTGGGAGTGGGGAGACAATGG + Intergenic
945945800 2:215994567-215994589 AAGAGGGAGAAGAGGGAGAAGGG + Intronic
945975204 2:216265057-216265079 AGGTTGAAGAGGTGGGAAAAAGG + Intronic
946110715 2:217412875-217412897 AAGTGGGAGAGAAAGTACAAAGG + Intronic
946632496 2:221685355-221685377 AGGAGGCTGAGGTGGGACAATGG - Intergenic
946884780 2:224211988-224212010 GGGTGGGAGTGGAGGGAGGAGGG - Intergenic
947224042 2:227822941-227822963 TGGTGGGAGAGGAGTGAGAGAGG + Intergenic
947454122 2:230237462-230237484 AGGTGGGGCAGGAGAGAGAATGG + Intronic
947628710 2:231637662-231637684 AAGTGGGGGAGGAGGGGAAAAGG + Intergenic
947637883 2:231689220-231689242 AGGTGGGGGAAGGAGGACAAAGG - Intergenic
947666768 2:231910903-231910925 AGGTGGGTGGGGAGGGGCAGAGG - Intergenic
947768826 2:232654854-232654876 AGCTGGGAGAGGAAGCACCAGGG - Intronic
947831700 2:233146141-233146163 ACCTGGGAGAGGAGGGAAAGAGG - Exonic
948075693 2:235163728-235163750 AGATGGGAGAGAAAGGAGAAAGG - Intergenic
948282738 2:236760350-236760372 GGGAGGGAGAGGAGGGAGGAAGG + Intergenic
948525043 2:238566323-238566345 AGGTGGGAGAGTTGGGCCATTGG + Intergenic
948548970 2:238754854-238754876 AGGTGAAAAAGGAGGAACAAAGG + Intergenic
948855258 2:240727348-240727370 AGGGAGGAGAGGAAGGACAGAGG + Intronic
949060357 2:241953255-241953277 AGGGGGGAGGAGAGGGAGAAGGG + Intergenic
1168741247 20:193270-193292 AGGTGGGTATGGAGCGACAATGG + Intergenic
1168764098 20:370199-370221 AGGAGGCAGAGGAGGGAGGATGG - Intronic
1168908174 20:1423423-1423445 GGGTGGGAGGTGAGGGAGAAGGG + Intergenic
1168955980 20:1834691-1834713 AAGGGTGAGAGGAGGGAGAAGGG + Intergenic
1169165759 20:3422165-3422187 CTGAGGGAGTGGAGGGACAATGG + Intergenic
1169263309 20:4153069-4153091 AGGTGGGAAAGAAGGTAGAAGGG + Intronic
1169542306 20:6613390-6613412 GGCTTGGAGAGGAGGGACGAGGG + Intergenic
1169900832 20:10550414-10550436 GTGAGGGAGAGGAAGGACAAGGG - Intronic
1170293485 20:14797503-14797525 AGATGGGACAGCAGGCACAAAGG - Intronic
1170349631 20:15424613-15424635 AGGAGGCTGAGGAGGGAGAATGG + Intronic
1170598576 20:17823605-17823627 AGGAGGGGGAGGAGGGAGAAGGG - Intergenic
1170798287 20:19569423-19569445 AAGTGGGACAGGAGGGCCACAGG - Intronic
1171091658 20:22291014-22291036 AGAGGGGAGAGGATGGAAAAAGG - Intergenic
1171198902 20:23225360-23225382 CGATGGGAGAGGAGACACAAGGG - Intergenic
1171249788 20:23638498-23638520 AGGAGGGAGATGAGGGGCATGGG - Intergenic
1171252902 20:23663050-23663072 AGGTGGGAATGGAGGTAGAAAGG - Intergenic
1171259385 20:23718367-23718389 AGGTGGGAATGGAGGTAGAAGGG - Intergenic
1172184614 20:33023588-33023610 AGGGGGGAGATGAGGGAAGAGGG - Exonic
1172292132 20:33784120-33784142 ATGGGGAAGAGGAGGGAGAAGGG - Intronic
1172434772 20:34921217-34921239 AGGTCAGAGAGTTGGGACAATGG - Intronic
1172877925 20:38177319-38177341 AGGTGGGAGAGGACGGAGGCTGG + Intergenic
1172962688 20:38809589-38809611 AGCTGGGTGAGGATGGACAGAGG + Intronic
1173001822 20:39110448-39110470 AGGTGGGAGAGAAGGAAGAGGGG - Intergenic
1173201299 20:40957197-40957219 AAGCGGGAGAGAAGGGAGAAAGG + Intergenic
1173384404 20:42574566-42574588 GGGAGGGAGAGGAAGAACAAAGG + Intronic
1173670646 20:44796421-44796443 AGGAAGGAGAGGAGAGAGAAGGG + Intronic
1173969455 20:47140560-47140582 AGTTGGGAGAGGAGCGACAGGGG - Intronic
1174139028 20:48400088-48400110 AGGGGGCAGAGGAGCAACAAAGG - Intergenic
1174392628 20:50227166-50227188 AGATGGGAGATGAAGGACATGGG + Intergenic
1174478374 20:50813572-50813594 AGGTGGGAGAGAAGAGTCAAGGG + Intronic
1174842243 20:53911445-53911467 AGGACGGAGAGGAGTGACAGAGG + Intergenic
1174917079 20:54664736-54664758 ATGTTGTAGGGGAGGGACAAAGG + Intergenic
1175120140 20:56710771-56710793 AGGAGGGAGAGGAGGGAGAGGGG - Intergenic
1175164880 20:57036355-57036377 TGGTGGGAGAGGATGGACAGAGG - Intergenic
1175549884 20:59810499-59810521 AGGAGGCAGAGCAGAGACAAAGG - Intronic
1175668031 20:60877032-60877054 AGGTTGGAGAGGAGGCTGAAAGG - Intergenic
1175868129 20:62192351-62192373 AGCTGGGTGAGGAGGGGCACGGG + Intronic
1175921385 20:62451979-62452001 AAGAGGGAGAGGAGGGAGAAGGG + Intergenic
1175959297 20:62626926-62626948 AGGTGGCAGACGAGGGAAAGAGG - Intergenic
1176070280 20:63222626-63222648 AGGTGGGACAGGAATGAGAATGG + Intergenic
1176094850 20:63335903-63335925 AGGAAGAAGAGGAGGGAGAAGGG + Intergenic
1176125529 20:63472982-63473004 AGGGGGGAGAGGAGGGGGAGTGG + Intergenic
1176184155 20:63769084-63769106 GGGTGGGAGAGGAGGGCACATGG + Intronic
1176229265 20:64023459-64023481 ACCTGGGAGAGGACGGACAGAGG - Intronic
1176295514 21:5070031-5070053 AGGATGGAGATGAGGGACAATGG - Intergenic
1176384004 21:6127956-6127978 AGGAGAGAGAGGAGGGAGAGAGG + Intergenic
1176724706 21:10421415-10421437 AGGTAGAAGAGGAGGTACACAGG - Intergenic
1178144475 21:29722449-29722471 AGGTGGGTGAGGCAGGAGAATGG + Intronic
1178413380 21:32384096-32384118 AGGCAGGACAAGAGGGACAAGGG + Intronic
1178608928 21:34063284-34063306 AGATGGGAGAGCAGAGAAAAAGG + Intergenic
1178941880 21:36913408-36913430 GGGTGGGGTAGGAGGGAGAAGGG + Intronic
1179324955 21:40333467-40333489 AGGTGGCTGAGGAGGGAGGATGG - Intronic
1179739470 21:43410282-43410304 AGGAGAGAGAGGAGGGAGAGAGG - Intergenic
1179861536 21:44192093-44192115 AGGATGGAGATGAGGGACAATGG + Intergenic
1180050049 21:45326934-45326956 GGGTGGGACAGGAGGGAGAGAGG - Intergenic
1181283298 22:21735341-21735363 GGGCGGGAGAAGAGGGACAGCGG + Intronic
1181579607 22:23820730-23820752 AGGAGGAAAAGAAGGGACAATGG + Intronic
1181893186 22:26082929-26082951 AGATGGGAGTGGAGGGCAAATGG - Intergenic
1181954055 22:26575350-26575372 ATTTGGGAGAGGAGGCAAAAGGG - Intronic
1182081412 22:27531698-27531720 AGCTGGGAGTGGAGGGAAAAGGG + Intergenic
1182129976 22:27843714-27843736 AGGATGAAGAGGAGGGAAAAGGG + Intergenic
1182320517 22:29475941-29475963 AGGAGGGAGAGGAAGGAAAAGGG + Intergenic
1182573797 22:31259244-31259266 ATATGGGAGAGGATAGACAAAGG - Intronic
1182622064 22:31623742-31623764 AGGTAGTAGAGGACGGTCAAGGG + Exonic
1182972346 22:34590165-34590187 AGGTGGCAGAGAAGGAAGAATGG - Intergenic
1183226291 22:36552260-36552282 ACGCAGGAGAGCAGGGACAATGG - Intergenic
1183251308 22:36732277-36732299 ATGAGGGAGAGGAGGGGCATGGG - Intergenic
1183264604 22:36817486-36817508 AGGTAGGAGTGGAGAGAGAAAGG - Intronic
1183364375 22:37399475-37399497 AGGTGGGAGAGGTGGGCCGGTGG - Intronic
1183364404 22:37399553-37399575 AGGTGGGAGAGGTGGGCCGGTGG - Intronic
1183518963 22:38285254-38285276 AGGAAGGAGGGGAGGGACCAGGG - Intergenic
1183530129 22:38348840-38348862 AGGAGGCAGAGGAGGGAGCAGGG + Intronic
1183578650 22:38708896-38708918 ATGTGGGAGAGGATGGACGAGGG + Exonic
1183645124 22:39121380-39121402 AAGTGGGAGAGAAGAAACAAGGG + Intronic
1184089306 22:42283913-42283935 AGGCGGGGGAGGAGGGGAAAGGG + Intronic
1184135224 22:42544854-42544876 AGGTGGGAGAGCCAGGGCAAAGG - Intergenic
1184262533 22:43327439-43327461 GGGTGGTAGAGGATGGTCAAGGG + Intronic
1184366932 22:44057758-44057780 AGGAGGGAGAGGAGAGAGAGGGG + Intronic
1184509368 22:44924098-44924120 AGGAGGGAGGGGAGGGAAGAGGG + Intronic
1184518088 22:44975389-44975411 TGGAGGGAGGGGAGGGACAGGGG - Intronic
1184924165 22:47625835-47625857 TGGTGGGTATGGAGGGACAAGGG - Intergenic
949865048 3:8540598-8540620 AGGTGGGAGGGGAGGCAGGAAGG + Intronic
949936813 3:9121994-9122016 AGGAGGCAGAGAAGAGACAAAGG + Intronic
950139196 3:10603670-10603692 AGCTGGGGGAGGAGGAACAGAGG - Intronic
950187034 3:10951681-10951703 AGGAGGGAGAGGAGGGGAGAGGG - Intergenic
950266230 3:11575139-11575161 AGGTGGCAGAGTAGGGACTTGGG + Intronic
950329902 3:12148007-12148029 AGGTGGCTGAGGCGGGAGAATGG + Intronic
950431345 3:12952854-12952876 AGGTGGCAGAAGAGGGATGAGGG + Intronic
951241053 3:20286614-20286636 AGGAGGGAGAGGAAAGACAGAGG - Intergenic
951524840 3:23643944-23643966 AGGTGAGAGAAGAGGGAATACGG - Intergenic
951595741 3:24316487-24316509 TGGTGGGGGAGGAGGAACAAGGG - Intronic
951702874 3:25513509-25513531 AAGTGGGAGAGGAGGCAGAATGG - Intronic
951817118 3:26766546-26766568 AGGAGGCAAAGGAGGGACAGAGG - Intergenic
952945263 3:38474761-38474783 AGGTGGCAGGGGAAGCACAAGGG + Intronic
953268525 3:41416798-41416820 AGGAGGAAAAGGAGGGAGAAAGG + Intronic
953273912 3:41476028-41476050 GGGCAGGAGAGGAGGGAAAAAGG + Intronic
953346584 3:42181033-42181055 AGGTGTGACAGGTAGGACAAAGG + Intronic
953375484 3:42424647-42424669 AGGTGGGGGCAGAGGGAGAAGGG + Intergenic
953605314 3:44409872-44409894 AGGTGGGACAAAAGGGACCAGGG + Intergenic
953628359 3:44589523-44589545 AGGTGGTAGTGGAGGAACTATGG + Intronic
954104533 3:48402831-48402853 AAATGGGAAAGAAGGGACAATGG + Intergenic
954701164 3:52451591-52451613 AGGAGGCAGAGCAGGGACACTGG + Intronic
955076845 3:55621795-55621817 AGGAGGGAGAGAAAGAACAAAGG + Intronic
955281730 3:57600466-57600488 GGAAGGGAGAGGAGGGAAAAGGG - Intergenic
955583094 3:60446100-60446122 AGGGAGGGTAGGAGGGACAATGG + Intronic
955641196 3:61086938-61086960 TGGTGGGAGAGGAGTGAACAAGG - Intronic
955715549 3:61825747-61825769 AGGAGGATGAGGAGGGAGAATGG - Intronic
955752932 3:62200946-62200968 AGATAGTAGAGGAGGAACAATGG + Intronic
956035385 3:65085125-65085147 AGGTGGGATAGGAGGTATACAGG - Intergenic
956062037 3:65357473-65357495 GGGTGGGAAAGGAAGAACAAGGG - Intronic
956514667 3:70033679-70033701 AGGTGAGAGAGGATGAACTAGGG + Intergenic
956741572 3:72279955-72279977 AGGTTGGAGAGCAGGGAGGAAGG + Intergenic
956796358 3:72722186-72722208 AGGAGAGAGAGAAGGGAGAAAGG + Intergenic
956812914 3:72881747-72881769 AGGTGGGACAGGATGGTTAAAGG + Intergenic
956889928 3:73602689-73602711 AGGCGGGGGAAGAAGGACAATGG - Intronic
957084466 3:75667730-75667752 AGGTGGGGGGGGAGGGAGGAAGG + Intergenic
957466675 3:80602494-80602516 GGGAGGGAGGGAAGGGACAAGGG + Intergenic
957652920 3:83032538-83032560 AGAGGGAAGAGGAGGGAGAAGGG - Intergenic
958113059 3:89175829-89175851 AGGAGGAAGAGGAGAGAGAAGGG + Intronic
958787663 3:98615300-98615322 AGCAGGTAGAAGAGGGACAATGG + Intergenic
958985620 3:100776712-100776734 AGGGTGGAGAGCAGGGACTAGGG + Intronic
959340488 3:105123539-105123561 AGGTGGGAGAGAAGGAAGGAGGG + Intergenic
959352295 3:105281106-105281128 ATGTGGGGGAGGAAGGACAAAGG + Intergenic
960018829 3:112925663-112925685 AGGTGGGAGAGGTTGGACATGGG + Intronic
960053679 3:113261100-113261122 AGGTGGGAGAGACGGGGCAGTGG - Intronic
960331843 3:116369572-116369594 AGGAGGAAGAGGAGGGTCAACGG + Intronic
960488142 3:118278236-118278258 AGGGGGGAGAAGAGGGGCCATGG + Intergenic
960620703 3:119633956-119633978 AGGTGGGAGTAGAAGGACAGGGG + Intergenic
960913486 3:122673693-122673715 AGGTGGGAGAGGTGAGGCAAAGG + Intergenic
961428636 3:126864642-126864664 AGGTGGAGGAGGAGGAAAAAAGG - Intronic
961640309 3:128360728-128360750 GGGTGGGAGTGGAGGGAGGAGGG + Intronic
961787791 3:129357973-129357995 AGGTGGGAGTGGTAGGACAGAGG + Intergenic
961897672 3:130182174-130182196 AGGTGGGAGAGTAGCCACAGAGG + Intergenic
962197412 3:133376303-133376325 AGGTGGGAGAGGAGCCACCATGG - Intronic
962253532 3:133854446-133854468 AGGAGGGAGAGGAGGGTCATAGG - Intronic
962452849 3:135535288-135535310 AGGTGGGACAAGAGGGAAAGAGG + Intergenic
962733865 3:138306756-138306778 AGGTGGCAGAGGAGGAACATGGG + Intronic
962738525 3:138346634-138346656 AGGTGGGAGTGGAGGCACAGGGG + Intergenic
962865910 3:139447974-139447996 AGATGGGAAAGGAGGGGAAAGGG - Intergenic
962942076 3:140134232-140134254 TAGGGGGAGAGGAGGGATAAAGG - Intronic
963145474 3:141989556-141989578 AGGTGGGATAAGAGGTACAAGGG + Intronic
963603772 3:147397487-147397509 AGGAGGGGGAGGAGGCTCAAGGG - Intronic
963692368 3:148519999-148520021 AGTTGGGAGTGGAGTGACACAGG - Intergenic
963952163 3:151214605-151214627 AGAAGGAAGAGGAGGGAAAAGGG - Intronic
964297306 3:155247772-155247794 AAGAGGGAGAGGAGGTAGAAGGG + Intergenic
964939798 3:162143901-162143923 AAGTGGGAGAGGAAGGCAAATGG - Intergenic
965124232 3:164604298-164604320 AGGGGCTGGAGGAGGGACAAAGG + Intergenic
965370878 3:167861035-167861057 AGGTGGGAGGAGAGGGATAAAGG - Intergenic
965505829 3:169513604-169513626 AGGTAGAGGAGGAGGGAGAAAGG + Intronic
965657488 3:171004040-171004062 AGGTGGGGAAGGAATGACAAAGG - Intronic
965785148 3:172327503-172327525 AGGGGGCTGAGGAGGGAGAATGG - Intronic
965822382 3:172697664-172697686 TGGAGGGAGAGGAGGGAGAAGGG + Intronic
966815157 3:183884574-183884596 AGGCGAGAGAGGAGAGAGAAGGG + Intronic
966940123 3:184740969-184740991 AGGTGGGATGGGATGGGCAATGG - Intergenic
967011571 3:185439751-185439773 AGAAGGGAGAGGTGGGAAAAAGG - Intronic
967303554 3:188039544-188039566 GGCTGGGAGAGGAGGGGCCAAGG - Intergenic
967651076 3:191987994-191988016 AGGTGGGGGTGGAGGGAGTAGGG - Intergenic
967819240 3:193825943-193825965 AAATGAGAGAGAAGGGACAAAGG - Intergenic
967986719 3:195100673-195100695 TGGTGGACGAGGAGGGAGAAGGG - Intronic
968006564 3:195247205-195247227 AGATGGGAGAAGAGGGCGAACGG + Intronic
968937225 4:3617573-3617595 AGGAGGGAGGGGAGGGAAGAAGG - Intergenic
969183736 4:5460623-5460645 AGGTGGGATGGGAGGGGCAGAGG + Intronic
969212603 4:5699195-5699217 AGGTGTGGGAAGAGGGAAAATGG + Intronic
969332959 4:6490580-6490602 AGATGGGACAGGTGGGACAGAGG + Intronic
969363936 4:6683034-6683056 GGCTGGGAGAGGAGAGACAGAGG - Intergenic
969454764 4:7294823-7294845 AGGAGGGAGAGGAGGGGGAGGGG - Intronic
969706368 4:8794324-8794346 GGGTGGGAATGGAGGGACAGAGG + Intergenic
970698959 4:18711863-18711885 AGGAAGGAGAGGAAGGATAAAGG - Intergenic
971453485 4:26821863-26821885 AGGTGGAAGTGGAGAGAGAAGGG - Intergenic
971729693 4:30361438-30361460 AGGTGGCAGAGGAAGGACTCTGG - Intergenic
971963132 4:33515622-33515644 AAGAGGGAGAGGAGGGGGAAAGG - Intergenic
972011224 4:34184798-34184820 AGCTGGGAGAAGAGGGAAATGGG - Intergenic
972230909 4:37071924-37071946 AGGGGGCAGAGGAAGGAAAATGG - Intergenic
972579840 4:40385487-40385509 AGGAGGGAGAGAAGGAAGAAGGG + Intergenic
972693200 4:41419762-41419784 AGGAAGGAGAGGAGGGAAAAGGG - Intronic
972746345 4:41935782-41935804 AGGTGGGAGAAGAGGAAAGAAGG - Intronic
972782729 4:42300123-42300145 AGGAGGGAGGGGAGGAAGAAAGG - Intergenic
972933855 4:44106986-44107008 AGGTGGGAGAGGATGGCTAGTGG + Intergenic
973223098 4:47751447-47751469 AAATGGGAGAGAAGGGAAAATGG - Intronic
973885613 4:55318027-55318049 AGGAGGAAGAGGAAGGAGAAGGG + Intergenic
974384534 4:61187999-61188021 AGGTGGTAGAGCAAGGATAAGGG - Intergenic
974604902 4:64139625-64139647 AGTTGGGGGATGGGGGACAAGGG - Intergenic
974670649 4:65025844-65025866 AGGGAGGAAAGGAGGGAGAAAGG - Intergenic
974703087 4:65476585-65476607 CGGAGTGAGAGGAGGGATAAAGG + Intronic
975365704 4:73524964-73524986 AGGTAGGAAAGGAGTGGCAATGG + Intergenic
975536939 4:75460760-75460782 GGGAGGGAGAGAAGGGAAAAAGG + Intergenic
975873507 4:78808368-78808390 AGGAGGGTGAGGCGGGAGAATGG - Intronic
976132298 4:81897550-81897572 AGGGGGGAGAGGAGGAGGAAGGG - Intronic
976709076 4:88050077-88050099 AGGAGGCTGAGGAGGGAGAATGG - Intronic
977059069 4:92233782-92233804 AGGGTGGAGGGGAGGGACAGGGG + Intergenic
977443387 4:97098791-97098813 AGGTGGGAAAACAGGGACTATGG - Intergenic
978346747 4:107777965-107777987 AGGAGGGAGAGGGGGAAGAAAGG + Intergenic
978405126 4:108371104-108371126 AGGAGGGAGAGGGAGGCCAAGGG - Intergenic
979154670 4:117369305-117369327 AGGTGGGGCAGGAGGGGAAATGG - Intergenic
979390684 4:120123805-120123827 AGGAGGGAGAGAAGGGAGAAAGG - Intergenic
979994356 4:127412550-127412572 AGGTGGGGAAGGAGGGAGGAGGG + Intergenic
981616122 4:146646804-146646826 TGGTGGGAGTGGAGGGAGAGAGG - Intergenic
981927519 4:150155965-150155987 AGGTGGGAGAGGAGTGGCCTGGG + Intronic
982346188 4:154362735-154362757 AGGAGGAAGAGGAAGGAGAAGGG - Intronic
982771571 4:159401534-159401556 AGGCGGGAGAGGAAGAACAGAGG - Intergenic
982821393 4:159944437-159944459 AGAAGGGAGAGGAGGCAGAAGGG - Intergenic
983398539 4:167234172-167234194 ATCTGGGAGAGGAGACACAACGG + Exonic
983551399 4:169021086-169021108 GGGAGGGAGAAGCGGGACAAAGG - Intergenic
983666873 4:170192784-170192806 AGCTGGGAATGGAGGGACGATGG + Intergenic
983996103 4:174184272-174184294 GGGTTGGAGATGAGGGTCAAAGG + Intergenic
984070345 4:175103412-175103434 AGGGGAGGGAGGAGGGAGAAGGG + Intergenic
984070366 4:175103465-175103487 AGGGGAGGGAGGAGGGAGAAGGG + Intergenic
984261357 4:177446253-177446275 AGGTAGGAGATGTGGGAGAATGG + Intergenic
984381957 4:179005708-179005730 AGGTGGGAGAGAAAGAAGAAGGG + Intergenic
984567388 4:181347238-181347260 AGGTGGGTGAGGCAGGAGAATGG + Intergenic
985026470 4:185744010-185744032 AAATGGGAGAGGAGGGAAAGGGG - Intronic
985271266 4:188197004-188197026 AGGTGGGTGGGGAGGGGGAAGGG - Intergenic
985271302 4:188197124-188197146 AGGTGGGTGGGGAGTGAGAAGGG - Intergenic
985271350 4:188197304-188197326 AGGTGGGTGGGGAGTGAGAAGGG - Intergenic
985271397 4:188197484-188197506 AGGTGGGTGGGGAGTGAGAAGGG - Intergenic
985271411 4:188197544-188197566 AGGTGGGTGGGGAGTGAGAAGGG - Intergenic
985271425 4:188197604-188197626 AGGTGGGTGGGGAGGGGGAAGGG - Intergenic
985606550 5:861205-861227 GGGAGGCAGAGGAGGGGCAAAGG - Intronic
985633109 5:1023749-1023771 AGTGGGAAGAGCAGGGACAATGG - Intronic
985633143 5:1023872-1023894 AGTGGGAAGAGCAGGGACAATGG - Intronic
985633153 5:1023913-1023935 AGTGGGAAGAGCAGGGACAATGG - Intronic
985633219 5:1024159-1024181 AGTGGGAAGAGCAGGGACAATGG - Intronic
985633327 5:1024569-1024591 AGTGGGAAGAGCAGGGACAATGG - Intronic
985633393 5:1024815-1024837 AGTGGGAAGAGCAGGGACAAAGG - Intronic
985633413 5:1024897-1024919 AGTGGGAAGAGCAGGGACAAAGG - Intronic
985633475 5:1025143-1025165 AGTGGGAAGAGCAGGGACAAAGG - Intronic
985633563 5:1025512-1025534 AGTGGGAAGAGCAGGGACAACGG - Intronic
985715328 5:1455647-1455669 AGGTGGGAGGGAAAGAACAAAGG - Intergenic
985824619 5:2183195-2183217 GGGTGGGTGAGGAGGGGCCAGGG + Intergenic
985905939 5:2836693-2836715 GGGAGGCAGAGGAGGGAGAATGG - Intergenic
985930387 5:3052394-3052416 AAGTGGGAGAGGAGAGACAAAGG + Intergenic
986285609 5:6356170-6356192 AGGTGGAAGAGGAGAGTCAGGGG - Intergenic
986315468 5:6583601-6583623 AGGTGGCAGAGGAGAGGGAAGGG + Intergenic
986826949 5:11532266-11532288 AGGAGGGAGAAGAGGGAGAGGGG - Intronic
987188560 5:15450391-15450413 ATAGGGGAGGGGAGGGACAAGGG - Intergenic
987232120 5:15905846-15905868 GGGTCGAAGAGGAGGCACAAGGG - Intronic
987251341 5:16104271-16104293 AGATGGAGGAGGAGGGATAAGGG - Intronic
987386531 5:17334816-17334838 AGCTGGGAGAGAAGGTATAAAGG - Intergenic
987536168 5:19190806-19190828 AGGAAAGAAAGGAGGGACAAAGG - Intergenic
987643369 5:20639958-20639980 AGGAGGCTGAGGAGGGAGAACGG - Intergenic
988993185 5:36690776-36690798 AGAAGGGAGATGAGGCACAAGGG - Intergenic
989144135 5:38231839-38231861 AGGTGAGAGAGGAGTGAGAGAGG + Intergenic
990142986 5:52726939-52726961 AAATGGGAGAGGAGTAACAATGG - Intergenic
990172825 5:53073711-53073733 TGGTGGTAGAGGAGGGACCAGGG - Intronic
990820490 5:59834265-59834287 AGGTGGGAGTGGGGGGAGCATGG - Intronic
990881414 5:60543207-60543229 ATGTGGAAGAGGAAGGACACTGG - Intergenic
991193007 5:63897599-63897621 TGGTGTGAGAGGAGGCACAGTGG + Intergenic
991530148 5:67605716-67605738 GGGTGGGAGTGGAGGGACAGAGG - Intergenic
991620724 5:68542992-68543014 AGGTGGGTGTGGGGGGAGAAAGG + Intergenic
991631088 5:68656956-68656978 AGGAAGGTGAGGAAGGACAAAGG - Intergenic
991927071 5:71716047-71716069 GGATGGGAGAGGAGGGTTAATGG + Intergenic
992149432 5:73888137-73888159 AAGTGGGAGAGCAGGGCCAATGG - Intronic
992428972 5:76689089-76689111 AGGCCAAAGAGGAGGGACAAAGG + Intronic
992582888 5:78200229-78200251 AGCAGGGGGAGGGGGGACAAGGG + Intronic
992605087 5:78447894-78447916 AGGAGGGAGAAGAGGGAGGAGGG - Intronic
992650963 5:78859766-78859788 CGGGGTGAGAGGAGGCACAATGG - Intronic
993204587 5:84863344-84863366 AGGGGGGAGGGGAGGGAGGAAGG - Intergenic
993477526 5:88383444-88383466 AGGTAGGAGAAGAGTGACCAAGG - Intergenic
993549358 5:89254779-89254801 AGGAGGGAAAGGAGGAAGAAAGG + Intergenic
993808549 5:92443226-92443248 AGGTGTCAGAGGAGGGAGAGAGG + Intergenic
994051989 5:95372735-95372757 TGGTGGGAGGGGTGGGCCAAAGG - Intergenic
994425650 5:99582550-99582572 AGGTGGGAGAAAAAGGAGAAGGG + Intergenic
994435692 5:99729692-99729714 AGGTGGGAGAAAAAGGAGAAGGG - Intergenic
994934700 5:106239111-106239133 GGATGGGAGGGGAGGGAAAAGGG + Intergenic
995106199 5:108380893-108380915 AGGTGGGAGAAGAGGGCGGAGGG + Exonic
995703328 5:114959479-114959501 TGGAGGGAGAGAAGGGGCAAGGG - Intergenic
996116449 5:119625387-119625409 AGGAGGAAGAGGAGGAACAAAGG - Intronic
996387527 5:122925068-122925090 AGAGGGAAGAGGAGGGAAAAGGG - Intronic
996543226 5:124651326-124651348 GGGTGGGAGAGGAGGCAAAGGGG + Intronic
996693533 5:126367483-126367505 AGGAGGGAGAGGAGGAAAAGGGG + Intronic
997013275 5:129904177-129904199 AGCTGGGGGAGGAGGGAAGAGGG + Intergenic
997384070 5:133458772-133458794 AGGTGGGAGAGGAGGAGGGAAGG + Intronic
997847198 5:137297656-137297678 AGGGTGGGGAGGTGGGACAAAGG + Intronic
998153058 5:139768206-139768228 GGGAGGAAGAGGAGGGAGAAAGG + Intergenic
998367141 5:141638878-141638900 AGGTTGGAGAAGAGGGAGCAAGG - Intronic
998460587 5:142307148-142307170 AGGTGGGAGAGGAAGGGAACAGG + Intergenic
998532741 5:142900593-142900615 AGGTGGGAGAGTAGGGGGAGGGG + Intronic
998597680 5:143550760-143550782 AGGAGGAAGAGGAGGGGTAAGGG - Intergenic
998885705 5:146691733-146691755 AGCAGGGAGAGGATGGACAGGGG - Intronic
999329382 5:150662316-150662338 AGGAGGAAGAGAAGGGACGAGGG + Intronic
999409728 5:151340211-151340233 AGGAGGGAGAGGAGGAGGAAGGG + Intronic
1000185132 5:158851549-158851571 AGGAGAGAGGGGAGGGAAAAAGG + Intronic
1000252553 5:159509476-159509498 GGGTGGGAGAGGAAGGAGAGAGG + Intergenic
1000480441 5:161767250-161767272 AAGTGGCAGGTGAGGGACAAAGG - Intergenic
1000753308 5:165124685-165124707 AGCTGAGAGAGGAGGAAGAATGG + Intergenic
1001103253 5:168831320-168831342 TGGAGGGAGAGGTGAGACAAGGG + Intronic
1001408704 5:171495287-171495309 AGGAAGGAAAGGAGGGACAGAGG + Intergenic
1001417489 5:171556101-171556123 AGGAGGGAGAGGAGGTAGAGAGG - Intergenic
1001545979 5:172570794-172570816 AGGAGGGAAAGGAGGGGAAAAGG + Intergenic
1001782606 5:174382982-174383004 AAGTGGAAGAGAAGGGTCAAAGG + Intergenic
1002045555 5:176539863-176539885 TGGTGTGAGAGGAGGGACTGGGG - Intergenic
1002091388 5:176808743-176808765 GGGTGGGAGAGGAGAGTCAGTGG - Intergenic
1002190749 5:177476201-177476223 AGGTGGGGGTGGAGGGAGGAGGG - Intergenic
1002294631 5:178223522-178223544 AGGTGGGAGGGCAGGGCCAATGG + Intronic
1002453232 5:179331396-179331418 TGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453241 5:179331416-179331438 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453250 5:179331436-179331458 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453259 5:179331456-179331478 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453268 5:179331476-179331498 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453277 5:179331496-179331518 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453286 5:179331516-179331538 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453295 5:179331536-179331558 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453304 5:179331556-179331578 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453313 5:179331576-179331598 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453322 5:179331596-179331618 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002588349 5:180267965-180267987 AGGAGGGTGAGGTGGGAGAATGG - Intronic
1002879475 6:1238430-1238452 TGGGGGGAGAGGAGGGACCCCGG + Intergenic
1003177684 6:3764949-3764971 AGGTGGGTGGGGAGGGACTTGGG - Intergenic
1003369123 6:5507780-5507802 CGGAGGGAGCAGAGGGACAAGGG + Intronic
1003681155 6:8258401-8258423 AGGAGGGAGAGGAGGAAGAAGGG + Intergenic
1003823294 6:9924486-9924508 AGGAGGGAGAGGAGCAAAAAAGG + Intronic
1004320158 6:14625876-14625898 AGAAGGGAGAGGAGAGAAAATGG + Intergenic
1004483835 6:16047005-16047027 AGGTGAGAGAGAAAGCACAAGGG + Intergenic
1004710853 6:18168974-18168996 AGGTGGCAGAGGCAGGAGAATGG - Intronic
1004748578 6:18537676-18537698 AGTAGGGAGAGCAGGGAAAAAGG - Intergenic
1005333914 6:24774779-24774801 GGGTCGGAGGGGAGGGTCAAAGG + Intergenic
1005495387 6:26383494-26383516 AGGGGGAAGTGGAGGGACGAGGG + Intronic
1005600338 6:27420446-27420468 AGTAGGGAGAGGAGGGATTAAGG - Intergenic
1005635991 6:27753526-27753548 AGGTGGGGGTGGAGGGAAAGGGG - Intergenic
1005685072 6:28246189-28246211 AACTGGGAGTGGAGGGAAAATGG + Intronic
1005821774 6:29604752-29604774 AGGAGTGAGAGGAGGGTGAACGG + Intronic
1006028966 6:31165293-31165315 AGGTGGGAAGGGGGTGACAAGGG + Intronic
1006055623 6:31382332-31382354 ATGTGGGAGAGGAGGAATTATGG + Intergenic
1006076060 6:31533222-31533244 AGGTGGGAGAGGAAAGAAAATGG + Intronic
1006211522 6:32399899-32399921 AGGTGGGAGAGGAGGGCTCTGGG - Intronic
1006642894 6:35497628-35497650 AGGTCGGGGAAGAGGGAGAAAGG - Intergenic
1007001902 6:38321302-38321324 AGGAGGGAGAAGAGGGAGAGAGG + Intronic
1007228909 6:40334542-40334564 AGGAGTGAGAGGAGGGAGAAAGG - Intergenic
1007298302 6:40845693-40845715 TGGTGGGAGAGGAGGGAGAGAGG + Intergenic
1007485803 6:42179677-42179699 AGCTGGGAGAGGAGTCAGAAGGG - Exonic
1007736503 6:43985344-43985366 AGCTGCGAGAGGAGGGAAGAGGG + Intergenic
1007924887 6:45642901-45642923 AGAGGGGAGAGGAGAGAGAAAGG - Intronic
1007979338 6:46134494-46134516 TTGTGGGAGAGGACGGACACAGG + Intronic
1008160472 6:48069156-48069178 GGGGGGGAGAGGAGGGAGAAGGG + Intergenic
1008228949 6:48959784-48959806 AGGAAGGAGAGGAGGGGAAAGGG - Intergenic
1008265873 6:49425759-49425781 AGCTGGGAGGGGAGGGGAAAAGG - Intergenic
1008395414 6:51000884-51000906 AAGTGGAGAAGGAGGGACAAAGG - Intergenic
1008663573 6:53694326-53694348 AGGTTGGAGAGCAAGGTCAAGGG + Intergenic
1009454388 6:63838640-63838662 AGGTGAGAGAGGAAGGCCAGTGG + Intronic
1009843333 6:69105235-69105257 AGGAGGGAAAGGTGGGAGAAAGG - Intronic
1009978879 6:70702733-70702755 AGGAGGCTGAGGTGGGACAATGG - Intronic
1010059269 6:71603910-71603932 AGGAGGGAGAGGAGGGAGAGAGG - Intergenic
1010451641 6:76010677-76010699 AGGTAGGAGAGTTGGGAAAATGG - Intronic
1012839808 6:104315893-104315915 AGGTGGGAGAGCTGGTACTAAGG + Intergenic
1013004269 6:106056910-106056932 AGGTGAGAATGCAGGGACAATGG + Intergenic
1013057971 6:106603544-106603566 AGGAGGGTGGGGCGGGACAAGGG + Intronic
1013206339 6:107949211-107949233 AGGTGGGAAAGGAGCTATAAAGG + Intronic
1013272810 6:108559441-108559463 AGTGGGGAGAGGAGGGAGAAGGG - Intergenic
1013425867 6:110012126-110012148 AGGTGGGAGAGAGGGAGCAAGGG - Intergenic
1013551412 6:111211184-111211206 AGGTGAGAGATGATGGACTATGG + Intronic
1013900368 6:115148497-115148519 AGGTGTGGCAGGAGGGAGAAAGG + Intergenic
1014288702 6:119533606-119533628 AGGAGGGAGAGGGAGGACAGAGG + Intergenic
1014655929 6:124103979-124104001 AGGAGGCTGAGGCGGGACAATGG + Intronic
1014896374 6:126904977-126904999 AGATGAGACAGGAGGGACATAGG - Intergenic
1014931346 6:127340379-127340401 AGAGGAGAGAGGAGGGAGAAAGG - Intronic
1015163966 6:130182625-130182647 AGGAGGGAGGGGAGGGAGGAAGG + Intronic
1015201339 6:130584785-130584807 ACGTGTGAGAGGAGGGAGTATGG - Intergenic
1015966332 6:138698322-138698344 AGGAGAGAGAGAAGGGAGAATGG - Intergenic
1016063646 6:139656098-139656120 AGGAGGGAAGGGAGGGAGAAAGG - Intergenic
1016169140 6:140987320-140987342 AGGTGGAATAGCATGGACAAAGG + Intergenic
1016203448 6:141442179-141442201 TGGTGGGAGAAAAGGGACAGAGG - Intergenic
1016486831 6:144549761-144549783 ATGTGGTACAGGAGGCACAAAGG + Intronic
1016532599 6:145075134-145075156 AGGAAGGAAAGGAGGGAGAAAGG + Intergenic
1016723042 6:147324687-147324709 AGGAGGAAGAAGAGGGAGAAAGG - Intronic
1016898308 6:149075567-149075589 AGGTGGCAGGGGAGGGGCAGTGG - Exonic
1016993880 6:149947487-149947509 AGGTGGGTGAGGAGGCAGGATGG + Intronic
1017004453 6:150020050-150020072 AGGTGGGTGAGGAGGCAGGATGG - Intronic
1017572632 6:155763634-155763656 AGTTGGGAGAGGAGGGGTGAGGG + Intergenic
1018641202 6:165906347-165906369 AAGTGGTAGAGAAGGGAGAAAGG - Intronic
1018862316 6:167720105-167720127 AGGCTGGAGAGCAGGGACAGCGG - Intergenic
1018866616 6:167751555-167751577 AGGAGGAAGAGGAGAGAAAAGGG - Intergenic
1018990688 6:168671437-168671459 AGGACGGAGAGGAGGGACCAGGG - Intronic
1018990707 6:168671490-168671512 AGGACGGAGAGGAGGGACCAGGG - Intronic
1019059205 6:169243158-169243180 AGGTGGGAGAGGTGGGAATGTGG - Intronic
1019059210 6:169243175-169243197 AGGTGGGAGAGGTGGGAAGGTGG - Intronic
1019215294 6:170439152-170439174 AGGTGGGAGAGAGGTGAGAAAGG - Intergenic
1019320709 7:414216-414238 AGGAGGGGGAGGAGGGAGGAGGG - Intergenic
1019320717 7:414232-414254 AGGAGGGGGAGGAGGGAGGAGGG - Intergenic
1019320725 7:414248-414270 AGGAGGGGGAGGAGGGAGGAGGG - Intergenic
1019320749 7:414310-414332 AGGAGGGGGAGGAGGGAGGAGGG - Intergenic
1019320757 7:414326-414348 AGGATGGAGAGGAGGGAGGAGGG - Intergenic
1019320763 7:414342-414364 AGGAGGGGGAGGAGGGAGGATGG - Intergenic
1019320770 7:414358-414380 AGGAGGGGGAGGAGGGAGGAGGG - Intergenic
1019381203 7:724778-724800 ATCTGGGAGAGCAGGGACCATGG + Intronic
1019495456 7:1337603-1337625 AGGAGGGAGAGGAGGGAGGGAGG - Intergenic
1019606164 7:1911297-1911319 AGGAGGGAGAGGAGGGTGACAGG - Intronic
1019825309 7:3279530-3279552 AGATGGGGGAGGAGGGAGAGAGG + Intergenic
1019890290 7:3941021-3941043 TGGTGGGTCAGGAGGGAGAAGGG - Intronic
1019963017 7:4477012-4477034 AGGAGGGAGAAGAGAGAGAAAGG + Intergenic
1019972312 7:4550790-4550812 GGGAGGGAGGAGAGGGACAAGGG + Intergenic
1020011478 7:4807954-4807976 AGGAGGGAGAGGAGAGAGACAGG - Intronic
1020080211 7:5282775-5282797 AGGGAGGAGAGGAGGGTGAAGGG + Intronic
1020246386 7:6432677-6432699 AGGTGGGAGAGGGGAGGGAAGGG + Intronic
1020550746 7:9601184-9601206 AGGTGGGAGTGGATGGACCAAGG + Intergenic
1021456246 7:20832217-20832239 AGGAGGGAGAGGAGGTACCAGGG - Intergenic
1021472737 7:21024326-21024348 AGGTGGGGAAGGAGGGAATAGGG - Intergenic
1021475090 7:21051634-21051656 ACGTGGGAAAGCAGGAACAAAGG - Intergenic
1021516770 7:21498011-21498033 AGGTTGAAGGGGAGTGACAAGGG - Intronic
1022414646 7:30167622-30167644 AGGTGGGAGAGGAGAGAAGGGGG - Intergenic
1022466752 7:30657190-30657212 GGCTGGGAGAGGAGGGACACAGG + Intronic
1022529440 7:31057771-31057793 AGGAGGGAGAGGAGGAAGTAGGG + Intronic
1022538236 7:31111508-31111530 AGGGAGGAGAGGAGGGGGAAGGG + Intergenic
1023088939 7:36600204-36600226 AGGGAGGAGAGGAGGGAGGAAGG - Intronic
1023586875 7:41739834-41739856 GGGAGGGAGAGGAGGAACTAAGG + Intergenic
1023654506 7:42406434-42406456 AGGGAGGAGAGTAGGGAAAAAGG + Intergenic
1023738943 7:43260752-43260774 ATGTGGGAGATGAGGGACACAGG + Intronic
1024028355 7:45433337-45433359 AGGAGGGAGAGGAAGGAGGAGGG - Intergenic
1024226645 7:47330619-47330641 AGGAGGGAGAGGAGGAACAGAGG + Intronic
1024344208 7:48296562-48296584 AGGAGGCTGAGGAGGGAGAATGG - Intronic
1024581189 7:50802375-50802397 AGGGAGGAGAGGAGGAATAAGGG + Intergenic
1024620867 7:51156816-51156838 AAGGGGGAGAGGAAGGAGAAGGG - Intronic
1024921171 7:54556430-54556452 AGGAGGGAGATGAGGGACTGAGG + Intronic
1025178898 7:56815189-56815211 AGGTGGGCGTGGAGGGCCCACGG + Intergenic
1025179334 7:56816979-56817001 AGGTGGGCGTGGAGGGCCCACGG + Intergenic
1025179792 7:56818865-56818887 AGGTGGGCGTGGAGGGCCCACGG + Intergenic
1025180241 7:56820703-56820725 AGGTGGGCGTGGAGGGCCCACGG + Intergenic
1025180712 7:56822685-56822707 AGGTGGGCGTGGAGGGCCCACGG + Intergenic
1025198706 7:56949422-56949444 AGGGAGGAGAGGAGGGTGAAGGG - Intergenic
1025673242 7:63627509-63627531 AGGGAGGAGAGGAGGGTAAAGGG + Intergenic
1025777107 7:64569453-64569475 AGGGCGGAGAGGAGGGCCAGGGG + Intergenic
1025976141 7:66371552-66371574 GGGAGGGAAAGGAGGGAGAAAGG + Intronic
1026466251 7:70657471-70657493 AGCTGGGAAAGGAAGCACAAAGG + Intronic
1026938932 7:74275504-74275526 GGGTGGGAGACCAGGGCCAAGGG + Intergenic
1027001500 7:74657726-74657748 AGCTGGGAGAGCAGAGAAAAGGG + Intronic
1027056016 7:75050029-75050051 ATGTGCAAGAGGAAGGACAATGG + Intronic
1027176991 7:75910728-75910750 AGGAGGGAGACCAGGGGCAAAGG - Intronic
1027397137 7:77767761-77767783 AGGGGGGAGAGGAGGGGAAGGGG - Intronic
1028223809 7:88226489-88226511 AGCTGGGAGAGGAGGGAATTTGG + Intronic
1028712267 7:93922407-93922429 AGGAGGTAGAGGAGGGAGCAAGG + Intronic
1029151919 7:98486315-98486337 AGCTGGGTGAGGGGGGACATGGG - Intergenic
1029423642 7:100484040-100484062 AGGTTGGGGTGGGGGGACAAGGG + Intronic
1029433633 7:100548735-100548757 AGGAGGAGGAGGAGGGAGAAAGG - Intronic
1029906676 7:104100049-104100071 AGATGGCAAAGGAGGAACAAAGG - Intergenic
1030197517 7:106867529-106867551 ACCTGGGAGCGGAGGGACACAGG - Exonic
1030555679 7:111021250-111021272 AGGAGTGAGAAGAGGGAGAAAGG - Intronic
1030862902 7:114658814-114658836 AGGTGGGGGAGAAGGGAGAAGGG - Intronic
1031595061 7:123640637-123640659 AGGGGGGAGAGGAGGGGGAGGGG + Intergenic
1031595071 7:123640655-123640677 AGGGGGGAGAGGAGGGGGAGGGG + Intergenic
1032025492 7:128438764-128438786 AGCTGGGAGCGGAGGTGCAAGGG - Intergenic
1032197664 7:129798762-129798784 AGGTGGGAGAGGAGCGGCCTGGG + Intergenic
1032308043 7:130755173-130755195 AGGTGGGAATGGAGGGGAAATGG - Intergenic
1032338160 7:131045448-131045470 GCTTGGGAGAGGAGGGAGAAAGG - Intergenic
1032344667 7:131107129-131107151 AGGTGGGGGACGTGGGAGAAAGG + Intergenic
1032407556 7:131667735-131667757 AGAAGGGAGAGGAAGGAAAAGGG - Intergenic
1032503470 7:132417706-132417728 AGGTGGGGGAGGAGGGGAGAGGG + Intronic
1033310649 7:140259586-140259608 AGGTGGGAGAGGAAGTCCCAAGG + Intergenic
1033310680 7:140259808-140259830 AGGTCAGGGAGAAGGGACAAGGG + Intergenic
1033558341 7:142508233-142508255 AGGTGGGAAAGGTGGGCCACAGG - Intergenic
1034021271 7:147645903-147645925 AGGTGGGAGAGGCAGAAAAATGG + Intronic
1034094049 7:148389933-148389955 CGGGGGGATAGGAGGGACACAGG + Intronic
1034549467 7:151811049-151811071 AGGTGGGATTGGAAGAACAAAGG + Intronic
1034613096 7:152390065-152390087 AGGTAGAAGAGGAGGCACACAGG + Intronic
1035466509 7:159083108-159083130 AGGTAGGACAGGTGGGACCAGGG - Intronic
1036258959 8:7225817-7225839 AGGTGGGGGAGGGGGGAGGATGG - Intergenic
1036311012 8:7684413-7684435 AGGTGGGGGAGGGGGGAGGATGG - Intergenic
1036505376 8:9350022-9350044 GGGTGGGAGAGGAGAGAAGAGGG + Intergenic
1036612525 8:10362639-10362661 TGGTGGGGGAGCAGGGACAACGG - Intronic
1037917066 8:22779075-22779097 AGGTGGGGGAGGAGGGGGATGGG + Intronic
1038179225 8:25210891-25210913 AGGAGGGAGAGGTGGGAGACAGG + Intronic
1038696611 8:29812287-29812309 GGGTGGGGGAGGTGGGGCAAGGG - Intergenic
1039427724 8:37500661-37500683 AGGTGGGAGAGGAGGAGGCAGGG - Intergenic
1039498649 8:38000117-38000139 AGCTGGGAGACAAAGGACAAGGG - Intergenic
1039500344 8:38011655-38011677 AGGAGGCTGAGGAGGGAGAATGG - Intergenic
1039909283 8:41811469-41811491 AGGTGGGAGTCGCGGGGCAATGG - Intronic
1040011019 8:42661301-42661323 AGGTGGGGGAGGAGGGAGAATGG - Intergenic
1040977306 8:53208033-53208055 AGGTGGGATAGGAGGGGAACGGG - Intergenic
1041674848 8:60527481-60527503 AGGCGGCAGGAGAGGGACAATGG + Intronic
1041746150 8:61211324-61211346 AGGAGGGAGAGGAAGGAAAGGGG - Intronic
1041797174 8:61757530-61757552 AGGAGGCTGAGGTGGGACAATGG + Intergenic
1041846143 8:62331033-62331055 AGGTAGAAGAGGAGGGAGGAAGG - Intronic
1041846154 8:62331126-62331148 GGGTGGAAGAGGAGGGAGGAAGG - Intronic
1041881176 8:62751214-62751236 AGGTGGGGTAGGAGGGAGAAGGG - Intronic
1042217297 8:66439188-66439210 AGGTTGGGGAGGAAGGAAAAGGG - Intronic
1042579689 8:70263232-70263254 AGTGTGGAGATGAGGGACAAAGG + Intronic
1043358048 8:79437040-79437062 AGGTGGGAGAGGAAGGAGGGAGG - Intergenic
1043443479 8:80297539-80297561 GGGTTGCAGGGGAGGGACAAGGG + Intergenic
1043887895 8:85623495-85623517 AGGGAGGAAAGGAGGGAGAAAGG - Intergenic
1044004222 8:86922294-86922316 AGGTGGGAGAGGAGACAAAAAGG + Intronic
1045026517 8:98092277-98092299 AGGAGGCCGAGGAGGGAGAATGG - Intronic
1045424168 8:102046948-102046970 AGGAGGGAGAGGAGCGGAAAAGG - Intronic
1048190117 8:132280672-132280694 AGCTGAGAGATGAGGGACAAAGG + Intronic
1048542109 8:135351854-135351876 AAGGGGTAGAGGAGGGACAAAGG + Intergenic
1049235577 8:141510712-141510734 AGGAGGGAGAGCAGGCACAGAGG - Intergenic
1049311771 8:141937360-141937382 AGGTGGGAGGGAAGGGAAGAGGG - Intergenic
1049370317 8:142261215-142261237 AGGAGGGAGAGAAGGGAAGAGGG + Intronic
1049408834 8:142463522-142463544 AGGTTAGAGAGGAGGGACCAAGG + Intronic
1049884298 9:17323-17345 AGGTGGGAGGGGTGGGACAGAGG - Intergenic
1049936194 9:504110-504132 GGGAGGGAGAGGAGGTACAGAGG + Intronic
1050024502 9:1319991-1320013 AGGAGAGAGAGGAGGCACCAGGG - Intergenic
1050032553 9:1401646-1401668 TGGTGCCAGAGGAGGCACAAAGG - Intergenic
1050077216 9:1877698-1877720 AGGTGGGAACTGAGGGACCAAGG + Intergenic
1050115639 9:2260654-2260676 AGGCAGCTGAGGAGGGACAATGG - Intergenic
1050398230 9:5222716-5222738 AGGTGGGAGAGGCAGGAGACTGG + Intergenic
1050658807 9:7859975-7859997 AGGGGGTAGAGGTGGGAGAAGGG + Intronic
1050703076 9:8363517-8363539 AGGTAAGAGAGGAGGAAAAAGGG - Intronic
1050945662 9:11513512-11513534 ATGTAGGAGGGGAGGGAAAATGG + Intergenic
1051272462 9:15368589-15368611 AGAAGGCAAAGGAGGGACAAAGG - Intergenic
1051431291 9:16983508-16983530 AAGTGGGAGACGAAGGACAGAGG + Intergenic
1051691549 9:19718395-19718417 AGGAGGCTGAGGTGGGACAATGG - Intronic
1052069557 9:24065478-24065500 AGGTGGAAGAGAAAGGAGAAAGG + Intergenic
1052409303 9:28102482-28102504 AGATGGGAGAAGAGGGCAAACGG + Intronic
1052605139 9:30689443-30689465 AGGAGGAAGTGGAGGAACAAGGG + Intergenic
1052975746 9:34408665-34408687 AGGAGAGAGAGGAGGGCCAAGGG - Intronic
1053140345 9:35678926-35678948 AGGTGGGAGGGAAGGGAGGAAGG - Intronic
1053316546 9:37056790-37056812 AGGAAGGAAAGAAGGGACAAAGG + Intergenic
1053337276 9:37286908-37286930 AGGTGGGAGGGGAGGGAGGGAGG - Intronic
1053456616 9:38238046-38238068 AGGTGGGAGCAGAGGGTCACTGG - Intergenic
1054453920 9:65420099-65420121 AGGAGGGAGGGGAGGGAAGAAGG + Intergenic
1054750338 9:68898700-68898722 AAGAGGGAGAGGAGGGAGGAAGG - Intronic
1054946719 9:70803859-70803881 AGGTGGGAGAGGTGGGAGTGAGG - Intronic
1055081988 9:72276480-72276502 AAATGGGAGAGGAGGTACACGGG - Intergenic
1055325098 9:75120576-75120598 AGGTCGGTGAGAAAGGACAAAGG - Intronic
1055567925 9:77587616-77587638 ATCTGGGGGAGGTGGGACAAAGG + Intronic
1055656040 9:78451344-78451366 AGGTGGGAGAGGCAGACCAAGGG + Intergenic
1056031639 9:82559799-82559821 AGGGGGGAGAGGAGAGAAAATGG + Intergenic
1056177652 9:84051113-84051135 AGTGGGGTGAGGAAGGACAATGG - Intergenic
1056900388 9:90593876-90593898 AGGTGGGAAAGGTGAGGCAAAGG - Intergenic
1056937801 9:90930795-90930817 AGGAGGGAAAGGAGGAAGAAAGG + Intergenic
1057003288 9:91532732-91532754 ATGTGGGAGAGGAGGTATATAGG - Intergenic
1058056128 9:100450830-100450852 AGATGGCAGAGGAGGAACACAGG + Exonic
1058236969 9:102502169-102502191 AGGAGGCAGAGGCGGGAGAATGG + Intergenic
1058700809 9:107598604-107598626 GGGTGGGAGGGAAGGGGCAATGG - Intergenic
1058841293 9:108912071-108912093 TGGTGGGGGAGGGGGGACAATGG + Intronic
1059421600 9:114195920-114195942 AGGTGGGTGAGGCAGGAAAACGG - Intronic
1059444191 9:114328048-114328070 TGTTGGGACAGGAGGTACAAAGG - Intergenic
1059445400 9:114334827-114334849 TGTTGGGACAGGAGGTACAAAGG - Exonic
1060202123 9:121657360-121657382 GGGTGGGTCAGGAAGGACAAAGG - Intronic
1060258131 9:122050610-122050632 ATGTGGGAGAGGACACACAAGGG - Intronic
1060471376 9:123951366-123951388 AGGGGGAAGAGCAGGCACAAAGG + Intergenic
1060553290 9:124495689-124495711 AGGTGGCGGAGGAGCGATAAGGG + Intronic
1060657277 9:125380684-125380706 AGGTGGAAGAGGCAGGATAAAGG - Intergenic
1060722854 9:125989964-125989986 AGGTGGGAGTGGAAAGTCAAGGG + Intergenic
1060772996 9:126346372-126346394 AGGTGGGGGAGTAGGGAGGAAGG + Intronic
1061084371 9:128390572-128390594 AGGTGGGAAGGGAGAGAAAACGG - Exonic
1061204326 9:129154390-129154412 AGGAGGGAGAGGAAGGAGAGGGG + Intergenic
1061308308 9:129745560-129745582 AGGTGGCAGAGGAGGGGCCCAGG + Intronic
1061448655 9:130656532-130656554 AGATGGGTCAGGAGGGACCACGG + Intergenic
1061754758 9:132804629-132804651 AGATGGGAGCAGAGGGACACGGG - Intronic
1061868112 9:133505887-133505909 AGGTAGGAGAGGAGGGGCAGAGG - Intergenic
1061994572 9:134177112-134177134 CAGGGGGAGAGGAGGGACATGGG - Intergenic
1061994590 9:134177167-134177189 ACGGGGGAGAGGAGGGACACAGG - Intergenic
1061994647 9:134177361-134177383 TGGGGGGAGAGGAGAGACACGGG - Intergenic
1061994658 9:134177398-134177420 GGGGGGAAGAGGAGGGACACGGG - Intergenic
1061994692 9:134177494-134177516 ACGGGGGAGAGGAGGGACACGGG - Intergenic
1062009178 9:134258148-134258170 TCCTGGGGGAGGAGGGACAATGG - Intergenic
1062445237 9:136590950-136590972 AGGCGGGAAAGGATGGACACTGG + Intergenic
1062470452 9:136701288-136701310 AGGTGGGGGTGGAGAGACAAGGG - Intergenic
1062570602 9:137183367-137183389 AGGTGGGGATGGGGGGACAAGGG - Intronic
1062623163 9:137431628-137431650 CAGTGGGAGGGGAGGGGCAATGG - Intronic
1062665375 9:137668293-137668315 AGAAGGGAGAGGAAGGAGAATGG - Intronic
1203747222 Un_GL000218v1:46380-46402 AGGGGGGATTGGAGGGACAGAGG + Intergenic
1185595943 X:1307075-1307097 GGGTGGGAGAGGAGCGCCAATGG - Intronic
1185608453 X:1380481-1380503 AGGGGGGAAAGGAGGGGGAAGGG + Intronic
1185749304 X:2597825-2597847 AGGTGGGAAAGCAGGCTCAAGGG + Intergenic
1185973664 X:4693949-4693971 TGGTGGAAGGTGAGGGACAAAGG + Intergenic
1186125553 X:6409980-6410002 AGGTGGAAGAGGAGGAAGAAAGG + Intergenic
1186137016 X:6532760-6532782 AGGTGTGTGGGGAGGGAGAAAGG - Intergenic
1186219300 X:7332557-7332579 AGGGGAGAGACGAGGGACAGAGG - Intronic
1186410557 X:9342173-9342195 AGGTGAGGGAGGGAGGACAAGGG - Intergenic
1186565197 X:10654801-10654823 AGTGGGGACTGGAGGGACAAAGG + Intronic
1187019534 X:15366109-15366131 AGGAGGCTGAGGAGGGAGAATGG - Intronic
1187116296 X:16355271-16355293 AGTGGGGATATGAGGGACAAAGG + Intergenic
1187131255 X:16505326-16505348 AGGAGAGAGAGAAGGGAGAAAGG - Intergenic
1187401829 X:18967044-18967066 AGGTGGGAGAGGGGAAAAAAGGG + Intronic
1187459987 X:19478031-19478053 AGGGGGGAGAGGGGGGAGAGAGG + Intronic
1187867907 X:23740771-23740793 AGGTGGAGGAGGTGGGAGAATGG + Intronic
1188000227 X:24973695-24973717 TGGTGGGAGGGGAGGGATTATGG - Intronic
1188267132 X:28091100-28091122 AAGTGGGAGAGGAGGCAAAAAGG - Intergenic
1189110596 X:38286083-38286105 AGGGGGAAGAGGAAGGAGAAGGG - Exonic
1189110642 X:38286209-38286231 AGGAAGGAGAGGAAGGAGAAGGG - Exonic
1189116805 X:38351368-38351390 AGGAAGGAGAGGAGGGGCAGGGG - Intronic
1189388676 X:40557876-40557898 ATGTAGGAGCTGAGGGACAAAGG + Intergenic
1189783767 X:44541722-44541744 AGGAGGGAGAAGAGGAACAGTGG + Intronic
1189974336 X:46446960-46446982 AAATGGGAGAAGGGGGACAAGGG + Exonic
1189976278 X:46463579-46463601 TGGTGGGAGAGGAATGAGAAGGG - Intronic
1190250274 X:48718197-48718219 AGATGGGGGAGGAGGAAGAAAGG - Intergenic
1190606081 X:52144430-52144452 GGGAGGGAGGGAAGGGACAAGGG - Intergenic
1190727246 X:53197621-53197643 AGGTGGGAGGGGTGAGGCAAGGG - Intronic
1192173013 X:68868375-68868397 AGGAGGGGGAGGAGGGACTCTGG - Intergenic
1192395497 X:70776763-70776785 GGGTGGGAGAGGGGAGAAAAGGG + Intronic
1193039143 X:76986557-76986579 AAGAGGAAGAGGAGGGAAAATGG - Intergenic
1193041398 X:77007408-77007430 AGGGAGGAGAGGGGAGACAAAGG + Intergenic
1193240409 X:79162350-79162372 TGAGGGGAGAGGAGAGACAAGGG + Intergenic
1194068084 X:89286462-89286484 AGGTGTCACAGGTGGGACAAAGG + Intergenic
1194429392 X:93782354-93782376 AGGTGGAAGAGCAAGCACAAAGG + Intergenic
1195101938 X:101563168-101563190 AGACAGGAGAGGAGGGAGAAGGG + Intergenic
1195109348 X:101629985-101630007 AGATGGGAGAGGAGGGAGAGGGG + Intergenic
1195129458 X:101839278-101839300 ACATAGGAGAGGAGAGACAAGGG + Intronic
1195176780 X:102320551-102320573 ACATAGGAGAGGAGAGACAAGGG - Intronic
1195182084 X:102366542-102366564 ACATAGGAGAGGAGAGACAAGGG + Intronic
1195227704 X:102815355-102815377 AGGTGGGAGATGAGGTTGAAAGG + Intergenic
1195298562 X:103504184-103504206 AGTGGGGAGAGGTGGGGCAAGGG + Intronic
1195520397 X:105822648-105822670 AGTTGGGAGTGGAGGGAAACCGG - Exonic
1195884681 X:109625676-109625698 AGGTGGGAGGGGGGTGAAAAGGG - Intronic
1195884895 X:109627417-109627439 AGGAGGGAGAGGTGGGAAAATGG - Intronic
1195942397 X:110176856-110176878 AGGTAGGGGAGGAGGAAAAAAGG + Exonic
1196505586 X:116437113-116437135 GGGAGGGAGAGAAGGGACAGGGG - Intronic
1196563026 X:117173501-117173523 AGCTGGGAGGGGAGGGAGAAGGG - Intergenic
1197537042 X:127702905-127702927 AGGAGGCTGAGGAGGGAGAATGG + Intergenic
1197766932 X:130065456-130065478 AAGTGGGAGATGAGGGGCATTGG + Exonic
1198097364 X:133393110-133393132 AAGTGGGAGAGGAGGGAGAATGG + Intronic
1198327190 X:135585440-135585462 AGGAGGGAGAGGAAGGAAGAGGG + Intergenic
1198377685 X:136055292-136055314 GGGAGGGAGAGGAGGGCTAAGGG + Intergenic
1199294488 X:146141725-146141747 AGGTAGCAGAGGAAGGAGAAGGG - Intergenic
1199676419 X:150193689-150193711 AGAGGGGAGAGCAGTGACAAGGG - Intergenic
1199868092 X:151872408-151872430 AAGAGGGAGAGGAAGGATAAAGG + Intergenic
1200069423 X:153520379-153520401 AGGTGGGGGAGGAGGTGAAAAGG - Intronic
1200088938 X:153625506-153625528 AGGTGGGTGAGGAGGGGCTGGGG + Intergenic
1200098315 X:153674397-153674419 AGGTGGAGGAGGAGGGGCCAGGG - Intronic
1200125897 X:153814725-153814747 ACCTGGGCGAGGGGGGACAAGGG - Intronic
1200127893 X:153825413-153825435 TGGTGGCAGTGGAGGGACATGGG + Intronic
1200266516 X:154649128-154649150 AGGTTGGTGAGGAGGGGGAATGG - Intergenic
1200401507 X:156022833-156022855 AGGTGGGAGGGGTGGGACAGAGG + Intergenic
1200722230 Y:6620620-6620642 AGGTGTCACAGGTGGGACAAAGG + Intergenic
1201329142 Y:12799237-12799259 GGCTGGCAGAGAAGGGACAATGG + Intronic
1201524679 Y:14919357-14919379 AGGAAGGAGAGAAGGAACAAGGG + Intergenic
1201625707 Y:16012245-16012267 AGGAGGGAGGGGAGGAAGAACGG + Intergenic