ID: 1114452232

View in Genome Browser
Species Human (GRCh38)
Location 14:22834946-22834968
Sequence CTTGACTGCCTGGCCAAAAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114452232_1114452235 4 Left 1114452232 14:22834946-22834968 CCAGTTTTGGCCAGGCAGTCAAG 0: 1
1: 0
2: 0
3: 4
4: 127
Right 1114452235 14:22834973-22834995 TAACAGCTCATGCACAGTTTAGG 0: 1
1: 0
2: 1
3: 6
4: 159
1114452232_1114452236 18 Left 1114452232 14:22834946-22834968 CCAGTTTTGGCCAGGCAGTCAAG 0: 1
1: 0
2: 0
3: 4
4: 127
Right 1114452236 14:22834987-22835009 CAGTTTAGGCCATGTACAGCTGG 0: 1
1: 0
2: 0
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114452232 Original CRISPR CTTGACTGCCTGGCCAAAAC TGG (reversed) Exonic
903332348 1:22602567-22602589 CTTGGCTGCCTGGCCAGGGCCGG + Exonic
906179201 1:43803923-43803945 CTTTCCAGCCTGGCCAAAGCAGG + Intronic
906451852 1:45956679-45956701 CTTGATTTCGTGGCTAAAACAGG - Intronic
908156882 1:61362479-61362501 CAGGACTCCCTGGCCAAAAGAGG + Intronic
909341804 1:74540768-74540790 CTTGAGTGCTTGGCTAAAAGGGG - Intronic
913539894 1:119808714-119808736 CTGAGCTGCCTGGCCAAAACAGG - Exonic
917670369 1:177268179-177268201 CTTTACTGCCAGGACAAAATGGG - Intronic
1064655758 10:17554005-17554027 CTTCTCTGCCTGGCCATACCAGG - Intergenic
1066445689 10:35480592-35480614 CTGGACTGCCTCTCCAACACAGG - Intronic
1067192247 10:44081557-44081579 CTTGACTGCTTGGGGACAACAGG + Intergenic
1069522058 10:69130311-69130333 CTTGACTTCCTAATCAAAACTGG - Intronic
1070614399 10:77958373-77958395 CTTGACATGCTGGCTAAAACGGG + Intergenic
1070759086 10:79012231-79012253 CGTGCCTGCCTGGCCAAGAATGG - Intergenic
1074876092 10:117614467-117614489 CTTGACTACCCTGTCAAAACTGG - Intergenic
1075273767 10:121075783-121075805 CTTGATTACCTGCCCAGAACTGG - Intergenic
1075350875 10:121723993-121724015 CTTTACTCCCTGGCCATAGCTGG + Intergenic
1079845293 11:25458860-25458882 CTTGAATGCCTGGCCTTAAGTGG - Intergenic
1082937686 11:58671469-58671491 CTTGAGTTCCTGGCCATGACAGG + Intronic
1084497310 11:69512648-69512670 TTTGACTGGATGGTCAAAACTGG + Intergenic
1085259725 11:75197541-75197563 CTTGAATGCCAGGCCAAGAGTGG + Intronic
1085566117 11:77515189-77515211 CATGTGTGCCTGGCAAAAACTGG + Intronic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1093415144 12:18911298-18911320 TTTGACTCCCTGGGCAAAGCTGG + Intergenic
1096602058 12:52736354-52736376 CTTGATTTTCTAGCCAAAACAGG + Intergenic
1096860901 12:54527388-54527410 CTTTCCTGCCTGGCCCCAACTGG - Intronic
1098033021 12:66273658-66273680 CTTGACTGCCAGCCCTAATCTGG + Intergenic
1099061653 12:77918384-77918406 CTAGACTGCCTGACCTAAAAAGG - Intronic
1099130392 12:78821999-78822021 CTTAACTCATTGGCCAAAACTGG - Intergenic
1102389518 12:112538133-112538155 CAGGACTGCCTGGCAATAACAGG + Intergenic
1106142560 13:27023474-27023496 CTACTCTGCCTGGCCAAAACTGG + Intergenic
1108249171 13:48547921-48547943 CTTAAATGCCTGGCTAAAAAAGG - Intergenic
1108506581 13:51117914-51117936 CTTGCCTGCATGGTCAAAAGTGG + Intergenic
1109855489 13:68121312-68121334 GATGACTGGCTGGCCAAAAGAGG + Intergenic
1113268873 13:108650658-108650680 CTTGGATTCCTGGCCCAAACAGG - Intronic
1114452232 14:22834946-22834968 CTTGACTGCCTGGCCAAAACTGG - Exonic
1115989211 14:39134416-39134438 TTTTACTGCCTGGCCAATAATGG - Intronic
1117387497 14:55230739-55230761 CCTGACTGCCTGCGCACAACAGG + Intergenic
1117718063 14:58600918-58600940 CTGGATTGCCTGGCAAGAACTGG + Intergenic
1118055405 14:62074457-62074479 CTTACCTGCCTGGCCTGAACTGG - Intronic
1118726351 14:68631751-68631773 CTTGGCTGCCTGGCCAGCTCTGG + Intronic
1119947295 14:78708358-78708380 CTTGACTGACTGGCTGAAATAGG + Intronic
1120256376 14:82124610-82124632 CTTAACTGCCTCCTCAAAACTGG - Intergenic
1122647309 14:103203704-103203726 CTTGAGTGCCAGGCCATGACAGG + Intergenic
1122861477 14:104584487-104584509 CTTGACTGCCTGTCCGTAGCAGG - Intronic
1125435126 15:39636151-39636173 CTTGACTGGTTGACCAAAACTGG - Intronic
1127837087 15:62798644-62798666 CTAGTCTGTCTGGACAAAACTGG + Intronic
1128723685 15:69972119-69972141 CTGGCCTGCTTGGTCAAAACAGG + Intergenic
1129480405 15:75820728-75820750 CTTGACTGCCTGGGCTCAAGTGG + Intergenic
1130288896 15:82579259-82579281 CAAGACTGCCTGGGCAACACAGG + Intronic
1132087731 15:98921850-98921872 CAGGACTGCCTGGCCAAGAGTGG + Intronic
1134355984 16:13482714-13482736 CTTGACTTCCTGGGCACAAGTGG - Intergenic
1134607479 16:15582498-15582520 CTTGTCTGCCTGCCCAAGACTGG - Intronic
1135763017 16:25152790-25152812 ATTGACTGCCAGGGCCAAACAGG - Intronic
1137056166 16:35747606-35747628 GTTGACTGCCTGGGGACAACCGG + Intergenic
1138216316 16:55207916-55207938 ATTCACTGCCAGGCCAAACCTGG - Intergenic
1142571487 17:877799-877821 CTGGCCTGCCTGGTGAAAACCGG - Intronic
1143820984 17:9562755-9562777 CTTCACAGCCTGGCCAACAGAGG - Intronic
1145216948 17:21060010-21060032 ACTGCCTGCCTGGCCATAACCGG - Intergenic
1145947735 17:28790094-28790116 CTTGATTTACTGGCCAAATCGGG + Intronic
1146013697 17:29215899-29215921 CTTGACTTCCTGGCCTCAAGTGG - Intergenic
1147601967 17:41752395-41752417 CCTGGCAGCCTGGCCAAAATGGG - Intergenic
1147887552 17:43694641-43694663 CTTGGCTGACAGGCCAAGACCGG + Intergenic
1153564125 18:6402298-6402320 CTTAACTTTCTGGCCAATACAGG - Intronic
1157280895 18:46345600-46345622 CTTGACTCCTAGGGCAAAACAGG + Intronic
1162199709 19:9011250-9011272 CTTGAGTGCCTGGACAAAGGGGG - Intergenic
1166944180 19:46387079-46387101 CGTGGTTGCCTGGCCAACACGGG - Exonic
1167031217 19:46962332-46962354 CTGGCCTGCCTTGCCAAGACTGG + Intronic
926923413 2:17961695-17961717 TTTTACAGCCTGGCCAAACCTGG + Intronic
928000877 2:27522231-27522253 CTTGACTGGCTGGGTTAAACTGG - Intronic
930933679 2:56920077-56920099 CAGGAATGCCTGGCCACAACAGG + Intergenic
931171221 2:59805515-59805537 TTCTACTGCCTGGCCAAAGCAGG - Intergenic
931685872 2:64792470-64792492 CTGGACTGCATGATCAAAACAGG + Intergenic
938373124 2:130786342-130786364 CTTGCCTGCCTGGCCAATCAAGG - Intergenic
945825551 2:214716710-214716732 CATTCCTGCCTGGCTAAAACAGG + Intergenic
947584070 2:231341418-231341440 CTTAACTAACTGGTCAAAACTGG + Intronic
947617603 2:231568508-231568530 CTTGTCTTCCAGGACAAAACAGG - Intergenic
1169636894 20:7702347-7702369 GTTTACTGCCTGGCTAAAATTGG - Intergenic
1172307900 20:33894620-33894642 CATGATTGCCTGGACAAAAAAGG - Intergenic
1174508027 20:51029511-51029533 CTTTCCTGCCTGGCAAAAATTGG + Intergenic
1175243146 20:57564439-57564461 CGTGAGTGCCTGGCTCAAACAGG - Intronic
1176140563 20:63543004-63543026 CTTGAGTGCCTTCCCCAAACTGG + Intronic
1179142025 21:38734059-38734081 CGCCACCGCCTGGCCAAAACTGG - Intergenic
1179648012 21:42787031-42787053 TTTGACTGCCTGGACACAAAAGG + Intergenic
1181643236 22:24215788-24215810 CTTGACTGCATGGCTAGAAGAGG - Intergenic
1181766109 22:25093251-25093273 CTAGGCTGCCTGCTCAAAACTGG - Intronic
1183328256 22:37205938-37205960 ATTGACTGCCTGGGCCAAAAGGG + Exonic
1184797263 22:46739402-46739424 CTTCACTGCATGGCCTGAACAGG - Intergenic
951120095 3:18916559-18916581 ATTGACTGCATGGCCCAAAATGG - Intergenic
954702283 3:52456514-52456536 GTGGGCTGCCTGGCAAAAACCGG + Intronic
955097664 3:55815791-55815813 GTTGACAGCCTTGTCAAAACTGG + Intronic
956506006 3:69940792-69940814 CTAAACTGCCTGCCCTAAACAGG - Intronic
960655443 3:119998730-119998752 CTTGAGCTCCTGGCCTAAACTGG - Intronic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
962720591 3:138171058-138171080 AGTGACTGCCTGGCAAAGACAGG + Intronic
966388897 3:179430674-179430696 CTTGACCTCCTGGCCTCAACTGG + Intronic
970242548 4:14024606-14024628 CTTCACTGCCTGGCCACACATGG - Intergenic
970360164 4:15301346-15301368 CTTGATTGCCTTGCCCAAAGTGG - Intergenic
974523220 4:63012644-63012666 AGTGAGAGCCTGGCCAAAACAGG + Intergenic
975695754 4:77011312-77011334 CTTTCCTGCTGGGCCAAAACTGG - Intronic
977336443 4:95705749-95705771 CTTGACAGACTGGCCAAGAAGGG + Intergenic
980974312 4:139596396-139596418 CTTGCATGCCTGGCCAAGAAGGG - Intronic
988684335 5:33513217-33513239 CATGACTGACTGGCCAGAATGGG - Intergenic
989139691 5:38190293-38190315 CTTCACTTCCTGCCCTAAACAGG - Intergenic
991275797 5:64844789-64844811 TTTGACTGCCTGGGTCAAACAGG - Intronic
992391448 5:76334883-76334905 CCTGACTGCCTGAACAAAATGGG + Intronic
1002323409 5:178389146-178389168 CTTGACTGACTCCCCAAACCTGG + Intronic
1005360244 6:25024366-25024388 ATTGCCTACCTGGCCAACACTGG - Intronic
1006365208 6:33611178-33611200 CCTGGCTGCCCGGCCAAAGCTGG - Intergenic
1008370519 6:50725100-50725122 CTTGGCTGCCTTGGCATAACAGG - Intronic
1022356963 7:29624986-29625008 CTTCACAGCCTTGCCAACACTGG - Intergenic
1023302808 7:38792019-38792041 CCAGACTGCCTGGCCAGAGCTGG + Intronic
1025978571 7:66389106-66389128 CTTGACTGCCTGGGCTCAAGTGG - Intronic
1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG + Intergenic
1028649195 7:93131654-93131676 CTTGATTTTCTGGCCAGAACAGG + Exonic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1036520437 8:9486644-9486666 CTTGACTACCTGTCCAACTCAGG - Intergenic
1044997234 8:97849211-97849233 CTTGACTCCCTAGCCTAAATTGG + Intronic
1045557826 8:103231847-103231869 CTTGGCTGCTTGGCCACATCTGG + Intergenic
1047878726 8:129169463-129169485 CTTGAGGGCCTTGCAAAAACAGG - Intergenic
1048012473 8:130469292-130469314 CCTAACTGGCTGGCCAACACTGG + Intergenic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1050791032 9:9470099-9470121 CCTGACAGCCTGGCCACCACTGG - Intronic
1052798478 9:32946089-32946111 ATTGCCTACCTGGCCAACACTGG + Intergenic
1056393870 9:86163882-86163904 CTTGTCTGCATGGTCAAACCTGG - Intergenic
1058167385 9:101635429-101635451 CTTTACCACCTGGCCCAAACAGG + Intronic
1060813474 9:126622996-126623018 ATTGACTGCATGCCCAACACTGG - Intronic
1062183723 9:135205131-135205153 CCTGACTGCTTGGCCAAGCCCGG - Intergenic
1192169075 X:68843334-68843356 CTTGACTGCCTGCCCAGAGTGGG + Intergenic
1193466054 X:81849073-81849095 CTTGACTTCCTGGATCAAACAGG - Intergenic
1195116684 X:101706387-101706409 CAAGACAGCCTGGCCAACACAGG - Intergenic
1200122683 X:153798566-153798588 CTTGTCTGCCTGGCCAGCAGAGG + Intergenic
1201054232 Y:9972681-9972703 CTTGGCTCCCTGTCCTAAACTGG - Intergenic