ID: 1114454468

View in Genome Browser
Species Human (GRCh38)
Location 14:22846145-22846167
Sequence GAGAGAAGCAAGGAGGCTGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 835
Summary {0: 1, 1: 0, 2: 7, 3: 87, 4: 740}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114454468_1114454482 30 Left 1114454468 14:22846145-22846167 CCCGCAGCCTCCTTGCTTCTCTC 0: 1
1: 0
2: 7
3: 87
4: 740
Right 1114454482 14:22846198-22846220 CGCCTCCCTCCCTCCTGCCCCGG 0: 1
1: 1
2: 12
3: 124
4: 1122
1114454468_1114454473 -9 Left 1114454468 14:22846145-22846167 CCCGCAGCCTCCTTGCTTCTCTC 0: 1
1: 0
2: 7
3: 87
4: 740
Right 1114454473 14:22846159-22846181 GCTTCTCTCTGTCCCCTGGCTGG 0: 1
1: 0
2: 7
3: 129
4: 1695

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114454468 Original CRISPR GAGAGAAGCAAGGAGGCTGC GGG (reversed) Exonic
900239831 1:1610829-1610851 GCGTGAAGCAAGCAGGCTGCAGG + Intergenic
900384414 1:2403083-2403105 TACAGAGGCAAGGAGGATGCCGG + Exonic
900400627 1:2471544-2471566 GACAGAAGAAAGGTGTCTGCTGG + Intronic
900634388 1:3654919-3654941 GAGAGAAGAGAAGAGGCTGAGGG + Intronic
900708204 1:4093939-4093961 CAGAGAAGGAAGGTGGGTGCTGG - Intergenic
901490792 1:9595335-9595357 GTGAGAGCCAAGGAGGCTGAGGG - Intronic
901866822 1:12111870-12111892 GAAAGAAGCAGAGAAGCTGCAGG - Intronic
901913646 1:12480964-12480986 GAGAGAAGCAAGCAGGCCTAGGG - Intronic
902377993 1:16039208-16039230 AAGAGAAGCCAGCAGGCAGCGGG - Intergenic
902383082 1:16061704-16061726 AAGAGAAGCCAGCAGGCAGCGGG - Intronic
902451439 1:16499188-16499210 GAGCGAAGGTAGGAGGCTGGGGG - Intergenic
902551707 1:17223379-17223401 GTGAGGAGCAAGGAGGGTGGGGG - Intronic
902668449 1:17955310-17955332 GAGAGAAGCAGAGATGCTTCTGG - Intergenic
903269112 1:22176778-22176800 GAGAGAGGCTGGGAGGCAGCAGG + Intergenic
903306053 1:22414152-22414174 GGGAGAAGCTAGGAGGGTTCTGG - Intergenic
903331733 1:22600127-22600149 GAGAGAAGGAAGGAGGAGGGAGG + Intronic
904092610 1:27955888-27955910 GAGAGAAGGAGGGAGGGAGCTGG - Intronic
904406329 1:30290844-30290866 GACAGAAACAAGGATGCTGGGGG + Intergenic
904409171 1:30314580-30314602 GGGAGAAGCAGGGAGGCACCAGG + Intergenic
904539635 1:31224183-31224205 GAGGGAGGGAAGGGGGCTGCTGG - Intronic
904859131 1:33521571-33521593 GAGAGCAGGTGGGAGGCTGCTGG + Intronic
905042428 1:34971133-34971155 GAGAGAAGCAGGGAGGTGCCAGG - Intergenic
905179141 1:36155987-36156009 GAGAGGCGCCGGGAGGCTGCGGG + Intronic
905323492 1:37133893-37133915 GAGAGGAGGAGAGAGGCTGCTGG + Intergenic
905734714 1:40317153-40317175 GAGGAGAACAAGGAGGCTGCGGG + Exonic
906203739 1:43975890-43975912 GAGAAAAGAAGAGAGGCTGCAGG - Intronic
906535062 1:46546918-46546940 GACAGAAGCAGGGAGGGTGCTGG + Intronic
906678695 1:47710575-47710597 GAGCGAAGCCTGGAAGCTGCGGG + Intergenic
906923431 1:50089232-50089254 AAAGGAAGCAAGGAGGCTACAGG + Intronic
907205664 1:52768396-52768418 GACAGAAGAAATGAGGCTGAAGG - Intronic
907724470 1:57006267-57006289 TAGAGATGCCAGTAGGCTGCTGG - Intronic
907786427 1:57617378-57617400 GAGAGAGACAAGCAGGCTGAAGG - Intronic
908037644 1:60073563-60073585 GACAGGTGCAAAGAGGCTGCAGG - Intronic
910189818 1:84583941-84583963 GAGTGAAGCCAAGAGGCTGAAGG - Intergenic
913381131 1:118211319-118211341 GAGAGAGTCAAGGTGGCAGCTGG + Intergenic
914341761 1:146765994-146766016 GAGGGAAGCAACGAGGAGGCTGG + Intergenic
914953721 1:152143351-152143373 GAGAGTAGAATGGTGGCTGCTGG - Intergenic
914960110 1:152197521-152197543 GAGAGAAGGAAGGAGGAAGGGGG - Intergenic
915011267 1:152688154-152688176 GAGAGAAGCAGGGAAACAGCAGG + Intergenic
915545554 1:156595376-156595398 GGAAAAGGCAAGGAGGCTGCAGG - Exonic
915702271 1:157807224-157807246 GAGAGATGCAGGGAGGGTCCAGG - Intronic
915733563 1:158070746-158070768 GAGAGAGGCAGAGAGGATGCTGG + Intronic
916349517 1:163833197-163833219 GAGAAAAGAAATGAGGCTGGAGG - Intergenic
916454109 1:164952993-164953015 GGGTGAAGCAGGGAAGCTGCTGG + Intergenic
916632887 1:166635936-166635958 GAGAGAAAAAAAGATGCTGCTGG - Intergenic
916666294 1:166970789-166970811 GAGAGAAGCATCCAGGCTGGGGG + Intronic
917246559 1:173008597-173008619 GAAAGAATCAAGGAGACTGAAGG - Intergenic
917481074 1:175412704-175412726 GAGAGAAGCAGAGAGGTTGATGG - Intronic
918350944 1:183655030-183655052 AAGAGAAGAAAGGAGTCTGTTGG - Intronic
919256836 1:195137109-195137131 GGGAGAGGCAAGGAGGCATCTGG - Intergenic
919614182 1:199784971-199784993 GAGAGAAGGTGGGAGGCTGATGG - Intergenic
919760023 1:201091934-201091956 GAGAGGAGAAAGGGGTCTGCAGG + Intronic
920067874 1:203282022-203282044 GAGAGGGGCAAGGAGGGTCCAGG - Intergenic
920261982 1:204694548-204694570 GAGAGCAGGAAGTAGGCAGCAGG - Intergenic
920672918 1:208018247-208018269 GAGGGGAGCAAAGAGGCTGGAGG - Intergenic
921431729 1:215073643-215073665 GAGAAAATCATGGAGCCTGCAGG + Intronic
921460174 1:215415784-215415806 GAGAGTAGGAAGGGAGCTGCTGG - Intergenic
921462805 1:215448861-215448883 GAGAGTAGGAAGGGAGCTGCTGG + Intergenic
921475012 1:215596240-215596262 AAGAGAAGCAGAGAGGCTGGTGG + Intronic
921692765 1:218170206-218170228 GAAAGAGGCAAGGAGACTGCTGG - Intergenic
922621558 1:226992411-226992433 GAGGGAAGAAAGGATCCTGCTGG - Exonic
922707145 1:227795643-227795665 GAGGGAAGGAAGGAGGTTGGGGG - Intergenic
923363232 1:233233718-233233740 GAGAGAGGCAGGGAGGATGGGGG + Intronic
923403114 1:233634582-233634604 GAGAGAGTCAACGAGGCTGAAGG + Intronic
923766356 1:236895550-236895572 GGTAGGAGCCAGGAGGCTGCGGG + Exonic
923851209 1:237797255-237797277 GAAATAAGCAAGGAAGCTGAAGG + Intronic
924040456 1:239979517-239979539 GAGAAATTCAAGCAGGCTGCAGG + Intergenic
924049214 1:240063406-240063428 TTAAGAAGCAAGGAGGCGGCCGG - Intronic
924094485 1:240537109-240537131 AAGGGAGGCAAGGAGGCTACAGG - Intronic
924101172 1:240604070-240604092 GAGAGAAGGAAGGGAGGTGCCGG + Intronic
924153166 1:241149693-241149715 GAGATAACTAAAGAGGCTGCTGG + Intronic
924160210 1:241223489-241223511 GAGAGGAGCAAGTAGGTTGTTGG + Intronic
924360515 1:243236487-243236509 GAGAGAATCTTGGAGCCTGCTGG - Intronic
924380760 1:243462122-243462144 GAGGGAATGAAGGGGGCTGCAGG + Intronic
1062939026 10:1407891-1407913 GAGAGAAGTGAGGAGGCTGGAGG + Intronic
1063379301 10:5574449-5574471 GAGAGGTGCAGAGAGGCTGCGGG + Intergenic
1063503785 10:6579027-6579049 GAGAGAGGCAAGAAGCCTGGAGG - Intronic
1063679385 10:8172483-8172505 GCGAGATGCAAGGAGGGAGCAGG + Intergenic
1064305621 10:14163686-14163708 GGGAGAAGCTTGGAAGCTGCTGG - Intronic
1064354786 10:14606667-14606689 GAGAGAAGGAAGGAGGGATCTGG - Intronic
1064674884 10:17750588-17750610 GACACAGCCAAGGAGGCTGCAGG - Intergenic
1064694198 10:17949431-17949453 CAGAGAAGCAAGGAGGGAGCAGG - Intergenic
1065136212 10:22672996-22673018 GAGACAGGAAATGAGGCTGCAGG - Intronic
1065244912 10:23747201-23747223 GCTAGAAACAAGAAGGCTGCTGG + Intronic
1065413167 10:25452902-25452924 GAGAGTAGAATGGTGGCTGCAGG - Intronic
1065487209 10:26247114-26247136 CAGAGCAGCCTGGAGGCTGCTGG + Intronic
1066263240 10:33749425-33749447 AAAAGCAGCCAGGAGGCTGCAGG + Intergenic
1066307176 10:34156746-34156768 GAGAAGAGCATGGAAGCTGCAGG - Intronic
1067083765 10:43227629-43227651 CAGGGCAGCAAGGAGCCTGCAGG + Intronic
1067248036 10:44562530-44562552 CAGAGTAGCTAGCAGGCTGCTGG + Intergenic
1067459393 10:46446153-46446175 GATGGGAGCAATGAGGCTGCTGG + Intergenic
1067627801 10:47938477-47938499 GATGGGAGCAATGAGGCTGCTGG - Intergenic
1067718019 10:48704481-48704503 GCAAGAGGCCAGGAGGCTGCAGG - Intronic
1068211847 10:53930698-53930720 GGGAGGAGCAAGGAGGCCTCTGG - Intronic
1068946074 10:62730030-62730052 GAAGGAAACAAGGAGGCTGTGGG - Intergenic
1068948603 10:62755107-62755129 GAGAGAAGGAAGGAGGGAGGAGG + Intergenic
1069067238 10:63955375-63955397 GAGAGAGGTGAGGAAGCTGCAGG - Intergenic
1069169025 10:65201687-65201709 GAGAGAAGAAAGGATACTCCTGG + Intergenic
1069874691 10:71554492-71554514 GAGAGACGCAAGGAGTCTCCTGG - Intronic
1070600279 10:77861458-77861480 GAGAGAGGAGAGGAGGCGGCAGG + Intronic
1071139404 10:82490157-82490179 CAAAGAAGCAAGTTGGCTGCTGG - Intronic
1071345028 10:84684527-84684549 GCTAGAAGCAAGGAGCCAGCAGG - Intergenic
1071471013 10:85984102-85984124 GGGAGAGGTGAGGAGGCTGCTGG - Intronic
1071778853 10:88819810-88819832 GAGAAAAGCAAGGAATCTGCTGG - Intronic
1071829859 10:89360910-89360932 GAGGCAAGGAAGGATGCTGCGGG - Intronic
1072040931 10:91606013-91606035 GGGAGAGGCAAGGAGGCATCTGG - Intergenic
1072272297 10:93788421-93788443 GAGATAATCAAGGATGGTGCAGG - Intronic
1072308868 10:94134694-94134716 GAGAGAAATAAGGAAGCTGCTGG + Intronic
1072638148 10:97190552-97190574 GAGAGAAGCAAAGTGGGTGCTGG + Intronic
1072944179 10:99795013-99795035 GAGAAAAGAAAGGAGGCAGTAGG + Intronic
1073104827 10:101026562-101026584 CAGAAAAGCAAGAAGGCTGGAGG + Intronic
1073136878 10:101225047-101225069 CAGAGAAGGAAGGAGACGGCAGG - Intergenic
1073139761 10:101239298-101239320 GAGAGAAATAGAGAGGCTGCAGG + Intergenic
1073215617 10:101834471-101834493 GAGAGTGGGAGGGAGGCTGCAGG - Intronic
1073369923 10:102978544-102978566 GAGACCAGCAAGGAGGCTAATGG - Intronic
1073642138 10:105263606-105263628 GAGTAAAGCGAGGAGGCTGTGGG - Exonic
1073984002 10:109187232-109187254 GTGAGGAGTAGGGAGGCTGCTGG + Intergenic
1074009384 10:109461173-109461195 GAGAGTAGCGTGGAAGCTGCTGG - Intergenic
1074110995 10:110422841-110422863 GAGGGAAGGAAGGAGGCTATAGG + Intergenic
1074279413 10:112036845-112036867 GAGAAGAGCAAAGAGGCTGTTGG + Intergenic
1074783755 10:116820929-116820951 GAGAGGAGTAAGGATGATGCTGG - Intergenic
1075249388 10:120851798-120851820 GAGAGAAGCCTGGAAGCTGGAGG - Intronic
1075674919 10:124289748-124289770 GAGGGAGGCAAGGAGGCACCGGG - Intergenic
1076050221 10:127327449-127327471 GAGAGAGGTGAGGAAGCTGCAGG - Intronic
1076242191 10:128916918-128916940 CACTGAAGCAGGGAGGCTGCAGG + Intergenic
1076427046 10:130374223-130374245 GAGAGGAGGAAGGAGGCTTCAGG + Intergenic
1076545828 10:131245247-131245269 GTGAGATGAAAGGAGCCTGCAGG + Intronic
1076815993 10:132914852-132914874 GAGCGAAGCCAGGAGGCTCAAGG - Intronic
1076907371 10:133369776-133369798 GAGGCAGGAAAGGAGGCTGCTGG + Intronic
1077028182 11:450879-450901 GAGAGACGCAAAGCGGCCGCAGG - Intronic
1077259300 11:1607298-1607320 GGGAGGAGCCAGGAGGTTGCGGG + Intergenic
1077334355 11:1996871-1996893 TTGCGCAGCAAGGAGGCTGCAGG - Intergenic
1077953791 11:6991287-6991309 GAGGGAAGCAGGGAGGCTAGGGG - Intergenic
1078084933 11:8228277-8228299 GAAAGAAGCAAGGAGGAGCCGGG - Intronic
1078490010 11:11759903-11759925 GAGAGATGCAAGGAAACTGAGGG + Intergenic
1078551819 11:12286305-12286327 GATTGAAGCCAGGAAGCTGCAGG - Intronic
1078805238 11:14693155-14693177 GAGAGAAGTAAGGAAGCTGCAGG + Intronic
1079129956 11:17741533-17741555 GAGAGCAGCTGGGGGGCTGCCGG - Intronic
1080952113 11:37045993-37046015 GAGAGAAACATGGAGGTTGGGGG + Intergenic
1081176680 11:39935704-39935726 GAGAGAGGTGAGGAAGCTGCAGG + Intergenic
1081760648 11:45574512-45574534 GAGATGAGCAAGGTGTCTGCAGG - Intergenic
1083433591 11:62627913-62627935 GAAACATGCAAGGAGGCTACTGG - Intronic
1083678278 11:64340071-64340093 CAGAGATGCTAGGAGGATGCAGG + Intergenic
1083707433 11:64526017-64526039 GAGAGCTGCCAAGAGGCTGCTGG - Intergenic
1083742700 11:64719518-64719540 GAGAGAAGCATGGAGCGGGCTGG + Intronic
1084529246 11:69717409-69717431 GAGAGAAGGAAGGAGACTGGAGG - Intergenic
1084738925 11:71125534-71125556 GAGAGAGGTGAGGAAGCTGCAGG + Intronic
1084916200 11:72430816-72430838 GAGAGGAGCAAGCAGGGTGTAGG + Intronic
1084952859 11:72676318-72676340 GAGGGCAGAAAGGAGGCTGAGGG - Intergenic
1084963048 11:72727231-72727253 GAGAGAGCCATGCAGGCTGCTGG - Intronic
1085048582 11:73367819-73367841 GGGAGAGGCAAGCAGGCTGAAGG - Exonic
1085373002 11:76028709-76028731 GAGAGAAATGAGGAAGCTGCAGG + Intronic
1085389057 11:76172925-76172947 CAGAGAAGGAAGGAGCCTGCTGG - Intergenic
1086329373 11:85738237-85738259 AAGAAAAGAAATGAGGCTGCAGG - Intronic
1086734219 11:90285670-90285692 GAGAGATGTGAGGAAGCTGCAGG - Intergenic
1086934276 11:92727808-92727830 GAGAGAAGACTGGAGCCTGCAGG - Intronic
1087666374 11:101053672-101053694 GAGAGAAGAAAGGAGGGAGAAGG - Intronic
1088190835 11:107226454-107226476 GGGAGAAGAAAGGAGGATGTGGG - Intergenic
1088254158 11:107887232-107887254 GAGAGTAGGAAGGAGACTTCTGG + Intronic
1088649944 11:111948691-111948713 GGGAGAATGAAGGAGGCTTCAGG - Intronic
1088675370 11:112187530-112187552 GGGAGAATGAAGGAGGCTTCAGG - Intronic
1089634214 11:119801988-119802010 GAGAGGAGCAGAGAGGCTGAGGG + Intergenic
1089752369 11:120660815-120660837 GGAAGAAGCCAGGAGTCTGCTGG + Intronic
1089890448 11:121875351-121875373 ATGAGAAGGATGGAGGCTGCAGG - Intergenic
1089928121 11:122280747-122280769 GAATGAAGCAAGGAGGGGGCTGG - Intergenic
1089928796 11:122287614-122287636 GAAATGAGCGAGGAGGCTGCTGG + Intergenic
1090211413 11:124923443-124923465 GAGAGAAGCAGAGAGGCAGGAGG + Intronic
1090456232 11:126851964-126851986 GGGTCAGGCAAGGAGGCTGCAGG - Intronic
1090570605 11:128040697-128040719 GAGAGAAGCCAGGTTGATGCTGG - Intergenic
1090902260 11:131043455-131043477 GACAGGAGCAAGATGGCTGCAGG - Intergenic
1202817338 11_KI270721v1_random:52053-52075 TTGCGCAGCAAGGAGGCTGCAGG - Intergenic
1091427098 12:400593-400615 GAGAAAGGCAGGGAGACTGCTGG + Intronic
1091859350 12:3765448-3765470 GAGGAAAGCAAGGATGCTGCAGG + Intergenic
1091949587 12:4581734-4581756 GAGAGAGGCAGGGAGGGAGCAGG - Intronic
1092008197 12:5087319-5087341 CCAAGAAGCAAGGAGGCTGGAGG - Intergenic
1092114466 12:5989058-5989080 GGGAGAGGGAAGGAGGCTACGGG + Intronic
1092171375 12:6375728-6375750 CAGACAGGCAAGGAGGCTGGGGG + Intronic
1092203947 12:6604422-6604444 CTGAGAAGCAGGGAGGCTGATGG - Intronic
1092329069 12:7566286-7566308 GGGAGAAGCAGGGAGGTCGCTGG - Intergenic
1093402073 12:18758493-18758515 GAGAGAGGTGAGGAAGCTGCAGG + Intergenic
1093417691 12:18939215-18939237 TAGAGAAGCAATTAAGCTGCAGG - Intergenic
1093472372 12:19516445-19516467 GAAAGAAGGAAGCAGGATGCAGG - Intronic
1094204915 12:27829868-27829890 GAGAGAGCCAAGGAGGGAGCAGG + Intergenic
1094350172 12:29515510-29515532 GGAAGAAGCAAGGAGGATTCTGG - Intronic
1096098983 12:48957425-48957447 GAGGGAAGGAAGGAGGGAGCCGG - Exonic
1096747446 12:53738132-53738154 TAGAGCAGCAAGAAGGCTGAAGG + Intergenic
1096766035 12:53890630-53890652 GAGAGAAGCAAGGAAAGTCCGGG - Intergenic
1096773656 12:53951440-53951462 GGGAGAGGCAACGTGGCTGCTGG - Intergenic
1097092918 12:56521839-56521861 GAGAGATGAAGGGGGGCTGCGGG - Intergenic
1097233845 12:57526998-57527020 GAAAGAGGCAAGGAGGTTGCTGG - Exonic
1097688572 12:62713375-62713397 GAGAGCTGAAAGAAGGCTGCTGG + Intronic
1099257704 12:80334625-80334647 GAGAAAATGTAGGAGGCTGCAGG + Intronic
1100091690 12:90980103-90980125 GAGAGACCAAAGGAGGCTCCAGG + Intronic
1100106697 12:91183809-91183831 GAGGGAAGGAAGGAGGCTGGAGG - Intergenic
1100705527 12:97196443-97196465 GATAGAATAAAGGAGGCTGCAGG - Intergenic
1100844479 12:98644851-98644873 CAGTGAAGCAACGAGGATGCCGG - Exonic
1101542429 12:105677038-105677060 GGGAGAAGCAAGGAAGCAGCAGG + Intergenic
1102540601 12:113616499-113616521 GGGAGGAGCCAGAAGGCTGCTGG + Intergenic
1103178333 12:118884770-118884792 GACAGAAGCAAGAAGAATGCAGG - Intergenic
1103330539 12:120150980-120151002 GAAAGCAGCAAGGACGCAGCTGG + Intronic
1103648916 12:122417885-122417907 GGGAGAAGGAAGGAGGAGGCAGG - Intronic
1103739002 12:123078691-123078713 CAGAGGAGAAGGGAGGCTGCTGG + Intronic
1103972461 12:124680675-124680697 GAGAGAACCAGGCAGGGTGCGGG - Intergenic
1104357193 12:128097695-128097717 GAGAGAAGGAAGGTGGTTGCCGG + Intergenic
1104454410 12:128898918-128898940 GAGAGAAGCAAGGAACTTGCTGG - Intronic
1104769877 12:131354765-131354787 AAGAGCAGAAAGGAGGCTGAGGG + Intergenic
1105306167 13:19170462-19170484 GAGAGATGCAGCGAGGCTGTGGG + Intergenic
1105356362 13:19663478-19663500 TGGAGCAGCAGGGAGGCTGCTGG + Intronic
1105806694 13:23955628-23955650 GAGAGTGGCAAGCAGGCTACAGG + Intergenic
1105821475 13:24084776-24084798 GTGAGAAGCCAAGAGGCAGCAGG + Intronic
1107301176 13:38967214-38967236 GAGAAATTCAAGGAGGTTGCAGG + Intronic
1107978545 13:45713448-45713470 GGGAGAAGTAGGGAGACTGCAGG - Exonic
1108010310 13:46000496-46000518 GAAAGAGGTAAGGAAGCTGCAGG - Intronic
1108079443 13:46719635-46719657 GAGATAAGCATGGACCCTGCAGG - Intronic
1108101585 13:46962500-46962522 GAGAGAAGGAAGGCGGGAGCTGG + Intergenic
1108730995 13:53235687-53235709 GAGACAAGAAAGAAGGATGCTGG - Intergenic
1108846636 13:54686262-54686284 GGGAGAGGCAAGGAGGCATCTGG - Intergenic
1109039254 13:57310853-57310875 GAGAGAAGCAGAGAAGCAGCTGG + Intergenic
1109113750 13:58354943-58354965 GAGAGAAGGAAGGAGGTATCAGG - Intergenic
1110034764 13:70669308-70669330 GAGGGAAGAAAGGAGGATGAGGG - Intergenic
1110882161 13:80585576-80585598 CAGAGAAACAGGGAGGATGCAGG - Intergenic
1111276164 13:85950209-85950231 GAGTAAAATAAGGAGGCTGCAGG - Intergenic
1111488564 13:88938297-88938319 GGGAGGAGCAAGGAGGCATCTGG - Intergenic
1113057206 13:106281710-106281732 AAGAGAAGTGAGGAAGCTGCAGG + Intergenic
1113890138 13:113731336-113731358 GAGAGAAGGTAGGAGGCGGCCGG + Exonic
1114454468 14:22846145-22846167 GAGAGAAGCAAGGAGGCTGCGGG - Exonic
1114491158 14:23102882-23102904 GGGAGAAGCAAACAGGTTGCAGG - Intergenic
1114617169 14:24074473-24074495 GAGAGCTGCAAGGAGGGTGGGGG - Intronic
1114621564 14:24099248-24099270 GTGAGAAGCAGGGCAGCTGCCGG + Intronic
1114680266 14:24478317-24478339 CAGAGAAGTGAGGAGGCTGGAGG + Intergenic
1115144921 14:30215404-30215426 AAGAGTAGCAAGGAGGCGGATGG - Intergenic
1116013927 14:39383848-39383870 GAGAGAGGTGAGGAAGCTGCAGG + Intronic
1116016501 14:39414270-39414292 GAGAGAGGTGAGGAAGCTGCAGG - Intronic
1116018512 14:39433510-39433532 GAAAGAAGGAAGAAGGCTGAAGG + Intergenic
1117063933 14:51989810-51989832 GAGAGGGGCCCGGAGGCTGCCGG - Intronic
1117227595 14:53678842-53678864 TAGAGAAGTAATGAGGCTGTGGG - Intergenic
1117799141 14:59425718-59425740 GAGGGAAGCAGTGAGGTTGCAGG + Intergenic
1117820030 14:59638683-59638705 GAGAGAGGTGAGGAAGCTGCAGG - Intronic
1118059776 14:62122740-62122762 GAGAGAAGAAAGATGGCTGATGG + Intergenic
1118855678 14:69620179-69620201 GACAGAAACAAGGAGGCAGACGG - Intronic
1119057583 14:71438837-71438859 GAGGGAGGCAAGTAAGCTGCAGG - Intronic
1119151100 14:72360223-72360245 GAAAGAAGAAAGGAGGCAGCCGG + Intronic
1119658758 14:76436030-76436052 GAGGGAAGCAAAGAAGATGCTGG - Intronic
1120224841 14:81779031-81779053 GAGGGAAGCAAGGAGCATGGTGG - Intergenic
1120929860 14:89837361-89837383 GAAGGAAGCAGGGAGGCTACAGG - Intronic
1120968115 14:90185187-90185209 GAGACAAGCATCGAGGCTTCAGG - Exonic
1121584956 14:95056969-95056991 GAGGGAAGGAAGGAAGCTGGAGG - Intergenic
1121691943 14:95884303-95884325 GAGGGAAGCAAGGGGGCAGGTGG - Intergenic
1121891336 14:97594040-97594062 GAGAGAAGCAGAGAGGCTTCAGG - Intergenic
1122418556 14:101561563-101561585 GAGCGGAGCATGGTGGCTGCAGG - Exonic
1122468603 14:101950774-101950796 GAGAACAGCAAGAAAGCTGCTGG - Intergenic
1122607252 14:102955024-102955046 GACCGGGGCAAGGAGGCTGCAGG - Intronic
1122797384 14:104212804-104212826 CAGGGCAGCAAGGTGGCTGCAGG + Intergenic
1122854545 14:104553926-104553948 GAGAGGAGAGAGGAGACTGCGGG + Intronic
1122940586 14:104979251-104979273 CAGGGCAGCAAGGAGGCTGAGGG + Intergenic
1123922452 15:25080009-25080031 CAGAGAAGCCAGGAAGCTCCTGG + Intergenic
1124010835 15:25837464-25837486 CAGAGTAGAAAGGAGGCTCCCGG + Intronic
1124721653 15:32115788-32115810 GAGAGAGGAAGGGAGGGTGCAGG + Intronic
1124828697 15:33126599-33126621 GAAAGAAGAAAGGAAGCAGCAGG + Intronic
1125103919 15:35948901-35948923 GAGATAGGCAAGGAGGATGAAGG - Intergenic
1125230364 15:37447813-37447835 GAGAGAAACAGGGAGGTTGTGGG - Intergenic
1126133304 15:45365548-45365570 GACAGAAAGTAGGAGGCTGCAGG + Intronic
1126135507 15:45386512-45386534 GAGAGGAGCCAGGTGGCTGTGGG - Intronic
1127207356 15:56733952-56733974 GAAAGAAGCAAGGGGCCTGTGGG + Intronic
1127259828 15:57319657-57319679 GATGGAAGCCAGGAGGCGGCGGG + Intergenic
1127272836 15:57416544-57416566 AACAGAAGCAAGATGGCTGCAGG - Intronic
1127958498 15:63873263-63873285 GAAGGAAGCAAGGAAGCTGTGGG - Intergenic
1127963560 15:63907757-63907779 TAGGGAAGCAAGGAGGAGGCAGG + Exonic
1128656878 15:69469135-69469157 GAGAGACTCAAGGAGGCTTCTGG - Intergenic
1128708480 15:69854820-69854842 GAGAGAAGCAAGAAGAATGCAGG - Intergenic
1129139265 15:73582412-73582434 GACAGAAGCAAGAAGGATGCAGG + Intronic
1130398242 15:83523733-83523755 GAGAGAAGGAGGGAGGCAGGGGG - Intronic
1130520894 15:84659833-84659855 GTGAGAAGCAAGGAGATTGGGGG - Intergenic
1131930956 15:97440459-97440481 GAGAGAAACAAGGAGACTAATGG + Intergenic
1132057387 15:98662674-98662696 GAGAGAAGTATGTGGGCTGCAGG + Intronic
1132097828 15:99000804-99000826 GAGAAAAAAAAGCAGGCTGCGGG + Intronic
1132150766 15:99456513-99456535 GGGACAAGCCAGGAGGTTGCCGG - Intergenic
1132221795 15:100110718-100110740 AAGAGCAGCAAGGAGGATGAAGG - Intronic
1132604142 16:786669-786691 GTGAGAAGCTGAGAGGCTGCAGG + Intronic
1132731905 16:1366908-1366930 GAGACAGGCAAGGAGGCCACAGG + Intronic
1132911844 16:2317770-2317792 GAGAGAAGCCATCACGCTGCTGG + Intronic
1133356680 16:5142014-5142036 CCTAGAAGCAAGGAGGCTGAGGG - Intergenic
1133522355 16:6571301-6571323 GGGAGGAGCAAGGAAGCTGCAGG + Intronic
1133718750 16:8474623-8474645 AAGAGAAACAAGGTGGCTGGGGG - Intergenic
1135144735 16:19951311-19951333 GAGAGAAGCCAGGAACCTGGAGG - Intergenic
1135597756 16:23756313-23756335 GGGGGAAGGAAGGTGGCTGCTGG + Intronic
1135669104 16:24360051-24360073 GAGAGAATTCAGGAGGCTCCTGG + Intronic
1135990276 16:27214588-27214610 GAAAGAAGTGAGGAGGCTGTTGG + Intronic
1136380789 16:29894402-29894424 GAGAGAAGGAGGGAGGCAGATGG - Intronic
1137726087 16:50657675-50657697 GAGATAAGGGAGGAGGCTGCAGG - Intergenic
1137783069 16:51114083-51114105 GGGAGAAGGAAGGGGGCCGCAGG + Intergenic
1138086277 16:54136478-54136500 GAGATTAGCCAGGATGCTGCTGG - Intergenic
1138130171 16:54472642-54472664 GAGAAAAGCAAGGAAGGTCCTGG + Intergenic
1138999363 16:62490472-62490494 GAGAGCCCCCAGGAGGCTGCTGG - Intergenic
1139293457 16:65878612-65878634 GAAAGAAGTAAGGTGGCTGCTGG + Intergenic
1139671836 16:68497491-68497513 CAGAGCAGAAAGGAGGCAGCAGG - Intergenic
1139690809 16:68640921-68640943 AAGGGAAGCAGGGAGGCTGGTGG - Intronic
1140249323 16:73281431-73281453 GAGAGTAGCATGGTGGTTGCAGG + Intergenic
1141598125 16:85109875-85109897 GTCAGGGGCAAGGAGGCTGCAGG - Intronic
1142365093 16:89645939-89645961 GAGAGACGCAGAGTGGCTGCCGG + Exonic
1142500077 17:327410-327432 GAGAGGAGCAGGGAGGCAGAAGG + Intronic
1142772212 17:2106642-2106664 GAGAGAGGGAAGGAGGATGCTGG + Intronic
1142953076 17:3500129-3500151 GAGAGAGGTGAGGAAGCTGCAGG + Exonic
1142967571 17:3590874-3590896 CAGAGAAGCAAGGAGGCCCAGGG + Intronic
1143107225 17:4535875-4535897 GAGAGAAGCAGCCAGGCTGGTGG + Intronic
1143313516 17:6013528-6013550 CAGAATAGCAGGGAGGCTGCGGG + Intronic
1143442897 17:6989241-6989263 GAGAGAGATAAGGAAGCTGCAGG + Intronic
1143544359 17:7587892-7587914 AAGGGAAGCAGGGAGGCTGGAGG - Exonic
1143555062 17:7654865-7654887 GAGAGAAGCAAGAGGAGTGCGGG - Intronic
1144625818 17:16844001-16844023 GAGAGAAGTAAGGAAGCTGGTGG - Intergenic
1144703850 17:17354800-17354822 GAGAGGGACAAGGAGTCTGCAGG + Intergenic
1144880614 17:18428719-18428741 GAGAGAAGTAAGGAAGCTGGTGG + Intergenic
1145151622 17:20515668-20515690 GAGAGAAGTAAGGAAGCTGGTGG - Intergenic
1145239483 17:21231796-21231818 GAGAGTGGCAAGGAGGCATCAGG + Intergenic
1146162979 17:30569926-30569948 GAGAGAAGTAAGGAAGCTGGTGG - Intergenic
1146270244 17:31480343-31480365 GAGGCAAGCAGGGAGGCAGCAGG + Intronic
1146624293 17:34424169-34424191 GAGAGAAGCGGGCAGGCTGCAGG - Intergenic
1147164281 17:38585207-38585229 GAGAGGAGCATGGAGACAGCTGG + Intronic
1147261607 17:39212359-39212381 GGCAGAAGCAAGGATGCTGACGG - Exonic
1147579970 17:41622692-41622714 GAGAGAAGTAAGGAAGCTGGTGG - Intronic
1147684731 17:42280317-42280339 GAGAGAGGGGAGGAGGCTGTAGG - Intergenic
1147924342 17:43937549-43937571 GGGATAAGCAAGGAGTTTGCGGG + Intergenic
1147938709 17:44029727-44029749 AGCGGAAGCAAGGAGGCTGCTGG - Intergenic
1148217008 17:45838827-45838849 GAGGGCAGCAAGGAGGCCTCAGG + Intergenic
1148542293 17:48490390-48490412 TAGACTAGCAGGGAGGCTGCTGG + Intergenic
1148820386 17:50356481-50356503 GGGAGAGGCAAGGAGGGTGAAGG - Intronic
1149658392 17:58322272-58322294 GAGGGAAGCTGGCAGGCTGCTGG - Intronic
1149683695 17:58522690-58522712 AAGAATAGCAAGGTGGCTGCAGG + Intronic
1150039946 17:61850025-61850047 GAGAGAAGCAAAGAGGAAGGAGG - Intronic
1151126890 17:71855101-71855123 GAGAGGGGCAAGCAGGCTGGTGG - Intergenic
1151221444 17:72615800-72615822 GAGAGAAGCAAAGGGACTGAGGG + Intergenic
1151440029 17:74122539-74122561 GATGGAAGCAGGGAGACTGCTGG - Intergenic
1151593819 17:75064584-75064606 CAGAGAAACAAGGAGACTGAGGG - Exonic
1151664310 17:75536617-75536639 GAGAGAAGGAAAGAGGCCCCAGG - Intronic
1151666049 17:75545607-75545629 CTGTGAAGCAGGGAGGCTGCTGG + Intronic
1151984755 17:77535054-77535076 GAGAGAAGCATGGAAACTCCAGG - Intergenic
1152231968 17:79118229-79118251 GAGAGAGGGAAGGAGCCAGCTGG - Intronic
1152241517 17:79163694-79163716 GAGGGAAGCAAGTGGGGTGCGGG - Intronic
1152285845 17:79412966-79412988 GAGAGCAGAAGGGAGGCTGGAGG - Intronic
1152334800 17:79694690-79694712 GACAGAAGAAAGGAAGCTCCTGG - Intergenic
1152511678 17:80794000-80794022 GAAAGAAACAGGGAGGCAGCTGG - Intronic
1152556448 17:81055439-81055461 GAGAGAAACAAGGCTGCTGCTGG - Intronic
1152640230 17:81446142-81446164 GAGAGAATCAAATAGGCTGGTGG - Intronic
1153083639 18:1257674-1257696 GAAAGAAGCCAGGAGGTTGAGGG + Intergenic
1153133137 18:1880966-1880988 GAGAGAGGTGAGGAAGCTGCAGG - Intergenic
1153761263 18:8334509-8334531 GACAGCAGCAATGTGGCTGCAGG - Intronic
1154072608 18:11166434-11166456 GAGAGAAGCAAGCGGAGTGCAGG + Intergenic
1154341690 18:13508187-13508209 GAGAGAGGTGAGGAAGCTGCAGG + Intronic
1154379770 18:13838493-13838515 GAGAGCAGCTAGGAGCCAGCTGG + Intergenic
1156483017 18:37447952-37447974 GATGGAAGCAAGGGAGCTGCAGG - Intronic
1156538746 18:37888986-37889008 TGGAGAAGCAAGGGGGCTGCAGG + Intergenic
1157227944 18:45884715-45884737 GAGTGAAGAAAGGAGACAGCAGG + Exonic
1157315894 18:46589365-46589387 GACAGAAGCAAGGAGCCCCCTGG + Intronic
1157327722 18:46680942-46680964 GAGAGAGAAACGGAGGCTGCAGG - Intronic
1157426870 18:47591643-47591665 GAGAGAAGGAAGCAGGGTGGAGG + Intergenic
1157560209 18:48640206-48640228 GAGTGCAGCAAGGAGCCAGCCGG - Intronic
1157598201 18:48876505-48876527 GAGGGAAGCAAGGAGGTTTTTGG - Intergenic
1157598618 18:48879039-48879061 GAAAGGAGACAGGAGGCTGCCGG - Intergenic
1157607502 18:48935154-48935176 GAGAGAAACAGAGAGGCTGGGGG + Intronic
1157812749 18:50709391-50709413 TGGTGGAGCAAGGAGGCTGCAGG - Intronic
1157845493 18:51000282-51000304 GAGAGCCTCCAGGAGGCTGCCGG - Intronic
1157877606 18:51288071-51288093 GAGAGCAGCAAAGTGACTGCTGG - Intergenic
1158594567 18:58804833-58804855 GAGAGAAGGAAGGAAGCTGTGGG - Intergenic
1158714438 18:59865367-59865389 GTGAGAAGTTAGGGGGCTGCAGG - Intergenic
1158746208 18:60202535-60202557 GAGGGTAGCAAGGAGCATGCAGG - Intergenic
1158984724 18:62802234-62802256 GGGAGGAGCATGGAGTCTGCAGG + Intronic
1159107353 18:64017776-64017798 GAAAGAAGGTAGGAGGCTGATGG - Intergenic
1159276757 18:66232051-66232073 GAGAGTCCCCAGGAGGCTGCTGG - Intergenic
1159594518 18:70370265-70370287 GAGAGCAGTAAGGAGTCTGAGGG - Intergenic
1159604185 18:70457958-70457980 CTCAGAAGGAAGGAGGCTGCTGG + Intergenic
1159895125 18:73989140-73989162 CAGAAAAGCAGGGAGGCTTCAGG - Intergenic
1160310025 18:77780471-77780493 GAGAGCAGCAAGCACACTGCTGG - Intergenic
1160312697 18:77810705-77810727 GAGGGAGACAAGGCGGCTGCAGG - Intergenic
1160341764 18:78095334-78095356 TAAAGAAGAAAGGATGCTGCAGG - Intergenic
1160596092 18:79975472-79975494 GTGAGGGGCAAGGAGGCTGCAGG - Intronic
1160695824 19:483823-483845 GAGGGAAGGAAGATGGCTGCAGG - Intergenic
1160845378 19:1163924-1163946 GAGAGAAGCACGTGGGCTCCTGG - Intronic
1160854377 19:1209800-1209822 GAGACAGGCAAGAAGGTTGCAGG + Intronic
1161315474 19:3615346-3615368 GAGAGCAGCACTGAGGCCGCCGG - Intronic
1161484559 19:4528203-4528225 CAGAAAAGCAGGGAGGCGGCCGG - Intronic
1161899342 19:7106374-7106396 GACAGAAACAAGGAGGGAGCAGG + Intergenic
1162099073 19:8328832-8328854 GAGAGCAGCCAGGAGGTTGCAGG + Intronic
1162604850 19:11698766-11698788 GAGAAAACCCAGGAGTCTGCTGG - Intergenic
1162811657 19:13167775-13167797 GAGAGAAGGAAGGGGGTTGGGGG - Intergenic
1162935501 19:13979667-13979689 CAGCCAAGCAAGGAGGGTGCTGG + Intronic
1163349040 19:16763833-16763855 GTGAGAACCACAGAGGCTGCGGG - Exonic
1163429432 19:17258264-17258286 AAAGGAAGCATGGAGGCTGCTGG - Exonic
1163468455 19:17483376-17483398 GAGGGAGGCAATGAGGCTGCTGG + Intronic
1164000637 19:21095233-21095255 GCTAGAAGCAAGGAGCCAGCAGG - Intronic
1164513534 19:28915838-28915860 CAGAGACCCAAGGAGGCTGAGGG - Intergenic
1164757347 19:30700055-30700077 GAGAGAAGGAGGGAGGCGGAGGG - Intronic
1164844757 19:31422424-31422446 GATCAAAGGAAGGAGGCTGCTGG - Intergenic
1165143747 19:33718718-33718740 GGGAGAAGCCAGGAGGATTCTGG - Intronic
1165298549 19:34949920-34949942 GAGAGAAACAAGGAGGAAGAGGG + Intergenic
1165306447 19:35005574-35005596 GAGACCAGGGAGGAGGCTGCTGG + Intronic
1165459899 19:35938135-35938157 GAGAGATGGACAGAGGCTGCTGG - Intronic
1165730581 19:38142359-38142381 GAGAGAAGCTGGGATGCTCCTGG - Intronic
1165739482 19:38196770-38196792 GGGGGGAGCAAGGAGGCTGAGGG + Intronic
1165941020 19:39414862-39414884 GAGAGGAGGAAGGAGCCTGTGGG + Intronic
1166349885 19:42191645-42191667 GAGAGAAGCCAGGAGGGGTCTGG + Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1167488897 19:49780603-49780625 GAGGGAGGCAAGAAGGCTGGAGG + Intronic
1167686779 19:50961487-50961509 GAGACAAGGATGGAGGCCGCGGG - Intronic
1168185859 19:54698849-54698871 GAGAGAAGCATCCAGGCTGCCGG + Intronic
1168237414 19:55071982-55072004 GAGTGAAGGATGGGGGCTGCAGG - Intergenic
1168314916 19:55480811-55480833 GAGAGCAGCAAGGAGGAGCCAGG + Intronic
1168612751 19:57814402-57814424 TGGAAAAGCAAGGAGGCTGGGGG - Intronic
925219045 2:2123012-2123034 GAGAGAAGCCAGGAGATTGAGGG + Intronic
925242436 2:2343746-2343768 CAGAGAAGCCAGGAGGCCTCAGG - Intergenic
925415264 2:3665904-3665926 GAGTGAAGTGTGGAGGCTGCTGG + Intronic
925658282 2:6173908-6173930 GAGAGAAGTGAGGAGACTGCAGG + Intergenic
925827466 2:7863462-7863484 GAAAGAAGAATGCAGGCTGCTGG + Intergenic
925827581 2:7864573-7864595 GAAAGAAGAATGCAGGCTGCTGG + Intergenic
925910074 2:8568061-8568083 GAGAGGGGAAAGGAGGCTGCTGG + Intergenic
926644946 2:15280374-15280396 GGGAGAAGGGAGAAGGCTGCCGG + Intronic
926687335 2:15708469-15708491 GAGGGAAGCATGGAGTGTGCTGG - Intronic
927256894 2:21047536-21047558 GAGAGAAGCCAGAAGTCAGCAGG + Intergenic
927285831 2:21355958-21355980 GAGAGAACCCAGGAGACTACAGG + Intergenic
927584105 2:24282964-24282986 GAGAAAAGAAAGGAGGAGGCAGG - Intronic
927720589 2:25379419-25379441 GGGAGAAGCAAGGAAGCCCCTGG - Intronic
928032703 2:27795312-27795334 CAAAGAAGCAGGGAGGCTCCTGG + Intronic
928065770 2:28163190-28163212 GGGGGAAGCAGGGTGGCTGCCGG - Intronic
929524906 2:42693106-42693128 GAGAGAAGGAAGGAGGGGGAGGG - Intronic
929641723 2:43587181-43587203 GAGAGAAGCAAGGTGGAAGCAGG - Intronic
929938823 2:46314968-46314990 GGGAGAAGGAGGCAGGCTGCTGG + Intronic
930831377 2:55747251-55747273 GAGAGAGGTGAGGAAGCTGCAGG + Intergenic
932685992 2:73870707-73870729 GGGTGAAGAGAGGAGGCTGCTGG - Intronic
933226398 2:79754318-79754340 GTGAGAAGCAGGGAGGCACCAGG - Intronic
933244953 2:79964773-79964795 AAGAGAAGCAACGAGGCTGGAGG - Intronic
933292406 2:80452635-80452657 GGGAGAAGAAAGGATGCTGGTGG + Intronic
933427065 2:82126702-82126724 GAGAGAAGAAAAGAAGCAGCTGG - Intergenic
933666595 2:84970432-84970454 GAGGGAAGCCAGGAGGCTGCCGG - Intergenic
933720531 2:85394831-85394853 CAGAGAAGCAAGCAGGCAGGTGG + Exonic
934084802 2:88501144-88501166 GACACAAGCAAGGTGGCTTCAGG + Intergenic
934731457 2:96661271-96661293 GGGAGAAGGAAGGAGGCTGCAGG + Intergenic
934745424 2:96756475-96756497 GAGGGAAGAAGGGAGGCTGAGGG - Intergenic
934951339 2:98577568-98577590 GAGTGAAGCAACGCGTCTGCAGG + Intronic
935039813 2:99415328-99415350 GAGAGAGTCAAGGAGGCTCCTGG + Intronic
935369827 2:102333490-102333512 AAGGGAGGCAAGGAGGCTGGAGG + Intronic
935387137 2:102512267-102512289 GAGACAAGTAAGGAGGCTGAGGG + Exonic
935523240 2:104135560-104135582 GAGAGAAGGCAGCAGGCTTCGGG + Intergenic
935784233 2:106534257-106534279 GAGAAAAGCAAGGAAGAGGCGGG + Intergenic
935881656 2:107571539-107571561 GATATAACCATGGAGGCTGCCGG - Intergenic
936155912 2:110047454-110047476 GAGAGAAGCAAGGAGGTTATGGG - Intergenic
936188776 2:110323974-110323996 GAGAGAAGCAAGGAGGTTATGGG + Intergenic
937217830 2:120323869-120323891 GTGAGGAGCAGGGAGGCAGCTGG - Intergenic
937453238 2:122019662-122019684 GAGGGAATCAAAGGGGCTGCAGG + Intergenic
937554707 2:123139546-123139568 GAGAGAAGCAGGGAGAGTGTGGG - Intergenic
938237543 2:129718281-129718303 GAGAGAAGCAAGAAAGGTGTAGG + Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
939394415 2:141610465-141610487 GAGAGTGGCAAGGGGGCTGTAGG - Intronic
939466363 2:142562006-142562028 GAGGGAGGCCAGGAGGCTGAGGG + Intergenic
939535375 2:143421395-143421417 CAGAGAGGCAGGGAGGGTGCAGG + Intronic
939543599 2:143524269-143524291 TAAAGAAACAAGGAGGCTGTTGG + Intronic
940178242 2:150903157-150903179 GTTAGAAGCAAGGAAGCAGCTGG + Intergenic
940184261 2:150965340-150965362 GAGAGAGGATAGGAGGCTTCTGG - Intergenic
940996538 2:160156278-160156300 GTGAGAGCCAAGGAGTCTGCTGG - Intronic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941225181 2:162839000-162839022 GAGAGAGAAAAGGAGGCTGGGGG + Intergenic
941585855 2:167358288-167358310 GAGTGAAGAAAGAAGGCTTCTGG + Intergenic
942204305 2:173604248-173604270 GAGAGAAGGAAATAGGCTGGAGG + Intergenic
943251674 2:185529353-185529375 GAGAGAAGTAAGGAAGCTCCAGG - Intergenic
943430987 2:187801015-187801037 TTGAGAATCAAGTAGGCTGCAGG - Intergenic
943859268 2:192838807-192838829 GAGAGAAGGAATAAGGCTTCTGG + Intergenic
944231559 2:197399046-197399068 GAGAGAAAAAAGGAGGCAGCTGG + Intronic
944320556 2:198336679-198336701 GAGCAAAGCAAGGAGTATGCTGG + Intronic
944800113 2:203230888-203230910 GAGAAATTCAAGCAGGCTGCAGG + Intergenic
946381500 2:219351947-219351969 GAGATAAGCAAGGGGGTTGGAGG + Intergenic
947522959 2:230862548-230862570 AAGGGGAGCCAGGAGGCTGCGGG - Intergenic
947827064 2:233113731-233113753 GAGAGAGGCAAGGATGGAGCTGG - Intronic
948423222 2:237873120-237873142 GAGGGGAGCAGGGAGGCTTCAGG + Intronic
948693766 2:239722557-239722579 GTGGGAAACAAGGAGGCAGCTGG - Intergenic
948825623 2:240572326-240572348 GAGAGAAGGCAGGAGGCTCTGGG - Intronic
948955088 2:241283224-241283246 GAGAGAGGTGAGGAAGCTGCAGG + Intronic
1169277212 20:4241862-4241884 GAGAGAAGGCAGGAGGAGGCAGG - Intronic
1169729794 20:8774288-8774310 AAGAAAAGCAAAGAGGCTGGGGG - Intronic
1170682761 20:18541164-18541186 GAGAGAGGTAAGGAAGCTGCAGG - Intronic
1170709257 20:18775339-18775361 TAGAGAACCAAGTAGGCTCCTGG - Intergenic
1170974610 20:21150390-21150412 CAGTGATTCAAGGAGGCTGCTGG - Intronic
1171465374 20:25324198-25324220 GAGAGGAGCAAGGTGACTGTGGG + Intronic
1172053415 20:32137248-32137270 GGGAGAGGCAAGGTGGCTGGAGG - Intronic
1172098623 20:32472918-32472940 GAGAGATGCAGGGAGGCTGGGGG - Intronic
1172205581 20:33160714-33160736 GAGAGAGGGAAGGAGGTTGGTGG - Intergenic
1173113544 20:40218544-40218566 GGGAGAAGGAAGGAGGCAGTGGG - Intergenic
1173786433 20:45796512-45796534 CAGAGAGGCAGGGAGGCAGCAGG - Intronic
1173837429 20:46135041-46135063 GAAAGCAGGAAGGAGGGTGCGGG - Intergenic
1174167480 20:48595409-48595431 GAAAAAAGGAAGGAAGCTGCAGG + Intergenic
1174189064 20:48727389-48727411 GAGAGAGGCAAGGGGGCTGCAGG - Intronic
1174320666 20:49739277-49739299 CAGAGAAGCAAGGCAGCAGCAGG - Intergenic
1174417098 20:50374732-50374754 GAGAGCAGGGAGGAGGCAGCAGG - Intergenic
1174768230 20:53273660-53273682 GAGGCCAGCAAGGAGGCTGTTGG + Intronic
1175052650 20:56169240-56169262 GAAAGAGTGAAGGAGGCTGCCGG - Intergenic
1175468486 20:59208953-59208975 GAGCTAAGCAGGGAGGCTGACGG - Intronic
1175623770 20:60473367-60473389 GGGAGAGTGAAGGAGGCTGCTGG - Intergenic
1175886081 20:62291743-62291765 GAGAGAAGCACGGAGGGAGCGGG + Exonic
1176025011 20:62981387-62981409 GAGAGACCCACGGAGGTTGCTGG - Intergenic
1176920646 21:14683755-14683777 GAGAGAAGGAAGGAGGGTAGGGG + Intergenic
1177046150 21:16172742-16172764 GAGAGAGGCGAGGAAGCTGCAGG - Intergenic
1177750268 21:25273178-25273200 GAGAGTAGGAAGGAGGTTACAGG + Intergenic
1178358566 21:31929669-31929691 GAGAAAAGCCACGGGGCTGCAGG + Intronic
1178758407 21:35376019-35376041 GAGAGTAGAAAGGTGGTTGCCGG - Intronic
1179237899 21:39563559-39563581 GAGAGAAGGAAGGAGGAAGGTGG - Intronic
1179238244 21:39566227-39566249 GAGAGAGGCATGGTGGCTGGGGG + Intronic
1180936612 22:19629644-19629666 GAGAGGAGAATGGAGGCTGGAGG + Intergenic
1181602769 22:23961901-23961923 GGGAGAAGAAAGGAGGTTCCCGG - Intergenic
1181605745 22:23979406-23979428 GGGAGAAGAAAGGAGGTTCCCGG + Intronic
1181861873 22:25825245-25825267 GAGAGATGCTGGGAGGCTGTGGG + Intronic
1182310694 22:29403516-29403538 GAGACCAGCTAGGAGGCTGGTGG + Intronic
1182690353 22:32157232-32157254 GAGACCAGCTAGGAGGCTGGTGG - Intronic
1183009297 22:34931724-34931746 AAGAGAAGCAAGGAGCCAGGAGG + Intergenic
1183012512 22:34958487-34958509 GAGAGAAGGAAAGAGGCTTTGGG - Intergenic
1183016145 22:34989266-34989288 GAGAGGAGAAAGGAAGCAGCAGG - Intergenic
1183692145 22:39396492-39396514 AAGAGAAGGAAGGAGGTGGCCGG - Intergenic
1183971643 22:41482032-41482054 AAGGGAAGAAAGGATGCTGCTGG - Intronic
1184388073 22:44187571-44187593 GAGAGAAGCAGGGAGTCTGCAGG + Intronic
1184515314 22:44958254-44958276 GAGAGAGTCAGGGAGGCAGCAGG - Intronic
1184525315 22:45019292-45019314 GAGGGAAGCAAGGAGCCTGCAGG - Intergenic
1184629426 22:45764029-45764051 GGGAGAAGCAGAGAGGCTGCCGG - Intronic
1184750837 22:46485645-46485667 GAGAGGTGCATGGAGCCTGCTGG - Intronic
1184944051 22:47788443-47788465 GAAAGAGACAAAGAGGCTGCAGG + Intergenic
1185064975 22:48627654-48627676 GAGCCAAGAAAGGAGGCTGCTGG - Intronic
950907491 3:16552423-16552445 CAGAGAAGCCTGGAGGCTTCAGG - Intergenic
952337901 3:32420833-32420855 GAGTCAAGCAAGCAGGCAGCAGG - Intronic
953174523 3:40537724-40537746 GAGAGAAGTGAGGAAGCTGCAGG + Intronic
953885433 3:46712249-46712271 GAGGGCAGCAAGGAGGCTGAGGG + Exonic
954713036 3:52514330-52514352 GAGAGAACCCAGGGGACTGCAGG - Intronic
955058141 3:55474264-55474286 GAGAGACCCGAGGAGGCTGGAGG + Intronic
955078046 3:55632338-55632360 AAGAGAAGCAAGGAGGCCCAGGG + Intronic
955580104 3:60410169-60410191 GAGAGAGGCAAGGAGGTATCAGG + Intronic
956113371 3:65893979-65894001 GAAACCAGCTAGGAGGCTGCAGG - Intronic
956163105 3:66375187-66375209 GAGAGAGGTGAGGAAGCTGCAGG + Intronic
956184671 3:66551143-66551165 CAGAGCAGTAAGGAGGTTGCAGG - Intergenic
957085769 3:75675230-75675252 GAGACTGGAAAGGAGGCTGCAGG + Intergenic
957508146 3:81152843-81152865 GAGAGAAGAAAAGAGCATGCAGG + Intergenic
957955721 3:87184464-87184486 GAGAGAAGTAAAGAAGTTGCAGG - Intergenic
958045602 3:88280384-88280406 AAGAGCAGCAAGGAAGCAGCAGG + Intergenic
960618797 3:119619940-119619962 GAGTGCAGAAAGGAGGCAGCCGG - Intronic
961010678 3:123433746-123433768 GAGGGAAGGGAGGAGGCTGCTGG - Intronic
961029765 3:123591297-123591319 GAGATATTCAAGCAGGCTGCAGG - Intergenic
961317816 3:126052483-126052505 GAGAGCAGGAGGAAGGCTGCTGG - Intronic
962552509 3:136509518-136509540 GACAGAAGCAAGGAAGTTGACGG + Intronic
962739188 3:138350340-138350362 GAGAGAAGCTAACTGGCTGCTGG - Intronic
962776010 3:138660539-138660561 GAGAGTAGAATGGTGGCTGCAGG + Intronic
963347244 3:144109747-144109769 GAGAGAAGCAAAGAGTCTTCTGG - Intergenic
963850711 3:150207876-150207898 GAGAGAAGCAAGCAGCTCGCTGG + Intergenic
964222572 3:154364061-154364083 GAGAGAAGAAGCGAAGCTGCTGG + Intronic
964758912 3:160115086-160115108 GAGAGCACCAAGGAGGCTCCTGG + Intergenic
966679964 3:182631540-182631562 GAGAGAAGCAAGGAAGCTAGGGG - Intergenic
968054401 3:195680488-195680510 GGGAGAAGCAAGGAGGAGGAGGG + Intergenic
968101490 3:195968670-195968692 GGGAGAAGCAAGGAGGAGGAGGG - Intergenic
969119786 4:4899682-4899704 GAGGCATGCAAGGATGCTGCGGG + Intergenic
969138332 4:5049107-5049129 GGAAGAAGAAAGGAGGCTACTGG - Intergenic
969500791 4:7551567-7551589 GAGAGAAGCAAAGAGCCCACTGG + Intronic
969700236 4:8764013-8764035 CAGAGCAGCAAGGAGGCCGTGGG + Intergenic
970426888 4:15954008-15954030 AAGAGCAGCTAGGGGGCTGCTGG - Intergenic
970657932 4:18252293-18252315 GGGAGCAGCAAAGAGCCTGCTGG + Intergenic
970708495 4:18833981-18834003 GAGAGAGGGAAGGAGGCACCAGG + Intergenic
970797396 4:19929637-19929659 GAGAAGGGCTAGGAGGCTGCTGG - Intergenic
971564796 4:28124277-28124299 GAGAGAAGTGAGGAAACTGCAGG - Intergenic
972305178 4:37823977-37823999 GAGAGATGTCATGAGGCTGCAGG - Intergenic
973329383 4:48896969-48896991 GTGAGATGCAAGGCAGCTGCTGG + Intronic
973633826 4:52843730-52843752 GAGAGAGGTAAAGAGGCTGAGGG - Intergenic
975521438 4:75305844-75305866 GAGAGAAGGAAGGATGCTGCAGG + Intergenic
975664866 4:76725730-76725752 GATAGAAGAAAGGTGGATGCTGG - Intronic
976014991 4:80542151-80542173 GAGAGCCGCTGGGAGGCTGCTGG - Intronic
976541089 4:86277284-86277306 GAGAGAAGCCATTAGGCAGCAGG - Intronic
977177233 4:93832264-93832286 GGGAGAAGCGAGCAGGCGGCTGG + Intergenic
977423494 4:96834655-96834677 GAGAGCAGCAAAAAGACTGCAGG + Intergenic
977425328 4:96861463-96861485 GAGACAAGCTTGGATGCTGCAGG + Intergenic
977612192 4:99047528-99047550 GGGAGAAGGAAGGAGGTTTCTGG - Intronic
977762225 4:100752533-100752555 GAGAGAGGTGAGGAAGCTGCAGG + Intronic
977787254 4:101051035-101051057 GAGAGCAGCCAGGATGCTGCTGG + Intronic
980189425 4:129504449-129504471 GAGGTAAGCAAAGAGGCTGCAGG + Intergenic
981563521 4:146073543-146073565 GAGACCAGCTAGGAGGCTACTGG - Intergenic
981822436 4:148901539-148901561 GAAGGAAGCAGGGAGGCTGTAGG - Intergenic
982036358 4:151349814-151349836 GAGAGAGGTAAGGAAGCTGCAGG + Intergenic
982927988 4:161364049-161364071 GAGAGAGGCAAGGAGACAGGAGG - Intergenic
983185870 4:164699927-164699949 GAGAGAAGAAAGTACGCTGTGGG + Intergenic
983438526 4:167749872-167749894 GGGAGAAAAAAGGAGGATGCAGG + Intergenic
983622105 4:169772700-169772722 GAGAGAAGCAGGGAGAGTTCAGG + Intergenic
984335865 4:178389368-178389390 GACAGATGAAAGGAGGCTGGTGG - Intergenic
984865278 4:184275489-184275511 GGCAGAAGTCAGGAGGCTGCGGG - Intergenic
985501469 5:250286-250308 GGGAGAAGCAAGGAGGAGGAGGG + Intronic
985552092 5:538892-538914 GAGAGAGTCAAGGAAGCAGCCGG + Intergenic
985676528 5:1234370-1234392 GAGAGGTGCCAGGAGGCTGATGG - Intronic
985735413 5:1577348-1577370 GGGAGAAGCAAGGAGGAGGAGGG - Intergenic
985890331 5:2710381-2710403 GAGAGATGTGTGGAGGCTGCTGG - Intergenic
986026655 5:3857649-3857671 GACAGAGGCAGGGAGGCTACTGG + Intergenic
986422406 5:7598290-7598312 CTCAGAAGCAAGGTGGCTGCAGG + Intronic
986859031 5:11904535-11904557 GAGAGAGGGGAGGAGGCCGCGGG + Intergenic
987124459 5:14798443-14798465 GGGAGGGGCAGGGAGGCTGCAGG + Intronic
987377434 5:17249258-17249280 GATGAAAGCAAGAAGGCTGCAGG - Intronic
987410812 5:17613015-17613037 GAGAGACACAAGGAGGGTACAGG + Intergenic
988791895 5:34616115-34616137 GAGAGAGGGAGGGAGACTGCTGG + Intergenic
989351137 5:40488010-40488032 GATGGAACCAAGGGGGCTGCAGG - Intergenic
990338245 5:54796052-54796074 GAGAGAAGCCAGGTGACTGCTGG - Intergenic
990346675 5:54878469-54878491 GTGAGAAGCAAGAAGGCTCTGGG + Intergenic
990826278 5:59902546-59902568 GAGAGAAGGAAGGAGCCCACAGG + Intronic
991009701 5:61870268-61870290 GAGAGGAGGAGGGAGGCTGCTGG - Intergenic
991299859 5:65119825-65119847 GAGGGAAGGAAGGAGGTAGCAGG - Intergenic
991447730 5:66717897-66717919 GAGGGAAGGAAGGAGGCCGTGGG + Intronic
992087017 5:73286893-73286915 GAAAGAAGCTAGGTGGCTGTTGG + Intergenic
992362907 5:76060537-76060559 GAGAGAGGTGAGGAAGCTGCAGG - Intergenic
992485378 5:77189643-77189665 TGGTGCAGCAAGGAGGCTGCTGG + Intergenic
992504219 5:77369414-77369436 AAGAGAAGCAGGGAGGATGAGGG + Intronic
992888649 5:81183966-81183988 GAGACAAGCAAGGAGCTTACAGG - Intronic
993455951 5:88127089-88127111 GAGAGAAACTAGGATGTTGCGGG - Intergenic
993768008 5:91886859-91886881 TACAGAAGTAAAGAGGCTGCAGG - Intergenic
994760951 5:103853345-103853367 GAGAGAGGTGAGGAAGCTGCAGG - Intergenic
995445977 5:112244450-112244472 GAGAGAAGAAAGGAGGGAGGAGG + Intronic
995478957 5:112576378-112576400 AAGGCAAGCCAGGAGGCTGCTGG + Intergenic
995487257 5:112651687-112651709 GAGAGAAGCAAGGGGGCAAATGG - Intergenic
995777282 5:115737548-115737570 GCCAGAAGGAAGGAGGATGCAGG - Intergenic
996413859 5:123188188-123188210 GAGAGAGGAAAGGGGGCTCCTGG - Exonic
996576719 5:124983871-124983893 GAGAGAAGAGAAGAGGCAGCTGG + Intergenic
996614897 5:125429554-125429576 GAGAGAAGAAAGAATGCTGATGG + Intergenic
997246366 5:132353127-132353149 GAGAGAAGCCAGGACTGTGCTGG - Intergenic
997577202 5:134989584-134989606 GAGAGAGAGAAGGAGGCTGCCGG - Intronic
997970151 5:138394830-138394852 CAGAGAAGTTAGGAGGCTGTTGG + Intronic
998038720 5:138937488-138937510 GCGAGCATAAAGGAGGCTGCAGG - Intergenic
998264170 5:140654814-140654836 GAAAGAAGAAAGGAGGTTGGGGG - Intronic
998532616 5:142899744-142899766 GAGAGAAGCAAGGGGGAAGTGGG + Intronic
999256249 5:150211395-150211417 GGGAGAGGGAAGGAGGCAGCGGG - Intronic
1000263218 5:159610079-159610101 GGGAGAAGCAAGCCTGCTGCAGG - Intergenic
1000693419 5:164350212-164350234 GAGAAACACAAGGAGACTGCAGG - Intergenic
1000871360 5:166581299-166581321 GAGAGAAGAAAAGGGGCTGCAGG + Intergenic
1001150548 5:169223875-169223897 GAGGGAAAGGAGGAGGCTGCAGG + Intronic
1001636249 5:173212524-173212546 GAAAGTAGAAAGGTGGCTGCTGG + Intergenic
1001837587 5:174845038-174845060 CAGAGAAGGCAGGAGGCTGACGG - Intergenic
1001924315 5:175625326-175625348 GTGAGCAGCAAGGACGCTGTTGG - Intergenic
1002094612 5:176823600-176823622 GAGAGACACAGGGAGGCTGAGGG + Intronic
1002147656 5:177197930-177197952 CAGAGAAGGGAGGATGCTGCAGG + Intronic
1002169764 5:177368396-177368418 GAGACAAGTAAGGAGGCTGAAGG - Intronic
1002474091 5:179454116-179454138 GAGAGATGCCAGCAGGCAGCTGG - Intergenic
1004458089 6:15810192-15810214 GAGGGAAACAGGGAGGCAGCTGG + Intergenic
1004959960 6:20776905-20776927 GGGAGCAGCAAAGAAGCTGCTGG - Intronic
1005083659 6:21981720-21981742 CAGAGTAGGAAGGAGGCGGCAGG - Intergenic
1005276788 6:24227980-24228002 AAGAGAAGGAAGGAGGTGGCAGG - Intronic
1006730404 6:36231745-36231767 GAAAGAAGGAAGGAGGCAGAGGG - Exonic
1006903113 6:37515757-37515779 GAAAGAAGGGAGGATGCTGCCGG - Intergenic
1007130300 6:39466230-39466252 GAGAGAAGGAAGGAGGAAGGGGG - Intronic
1007397592 6:41586508-41586530 CAGAGAATCAAGGAGTCTGACGG - Intronic
1007398878 6:41592382-41592404 GAGAGAAGCTGGGAGGCTGTTGG + Intronic
1007426283 6:41748383-41748405 GACAGAAGCAGGGACGCAGCGGG - Intronic
1007727163 6:43923589-43923611 GAGAGGAGCTTGGAGCCTGCTGG - Intergenic
1008413624 6:51213863-51213885 GAGCGAAGAAAGGAGGGGGCGGG + Intergenic
1011487611 6:87858985-87859007 GAGAGAACCAAGGAGATTCCAGG - Intergenic
1011836787 6:91441247-91441269 GAGAGAACCAAGGAGGTTTGGGG + Intergenic
1012995042 6:105964522-105964544 GAGAGAACCATGCAGGCTCCAGG + Intergenic
1013073469 6:106750310-106750332 GAGTGGTGCAGGGAGGCTGCTGG - Intergenic
1014882329 6:126738630-126738652 GAGAGAAGAAGGGAGGGAGCAGG - Intergenic
1014982857 6:127966008-127966030 GAGTGAAGCTAGAAGGCGGCTGG - Intergenic
1016313867 6:142764432-142764454 TAGAGAAGCAAGGCAGCAGCTGG - Intronic
1016564900 6:145441468-145441490 GAGAAATTCAAGCAGGCTGCAGG - Intergenic
1016753686 6:147660395-147660417 TAGGGAAGCAGGGTGGCTGCAGG - Intronic
1017017437 6:150113206-150113228 GGGGGAAGAAAGGAGGCTGGGGG - Intergenic
1017091627 6:150764081-150764103 GAGAGAAGCTATAAAGCTGCTGG - Intronic
1017753407 6:157509906-157509928 GAGAGCAGAGTGGAGGCTGCAGG - Intronic
1017859138 6:158379052-158379074 GAGACCAGTTAGGAGGCTGCTGG + Intronic
1018008631 6:159647677-159647699 GAGAGAAGGAAGAAGGATGGAGG + Intergenic
1018188291 6:161286924-161286946 GGGAGCACCCAGGAGGCTGCGGG + Intergenic
1018751729 6:166812421-166812443 GAGAGAGGCAAGGGGGCTGTGGG - Intronic
1018987317 6:168647612-168647634 GAGAGGAGCAACGAGGCTTGAGG - Intronic
1019300491 7:300706-300728 CACAGACGCAAGGAGGCTTCAGG - Intergenic
1019565467 7:1676668-1676690 GAGACAGGGAAGGAGGATGCTGG + Intergenic
1019757966 7:2787446-2787468 GAGTGCAGCAGGGAGGCTGACGG - Intronic
1019913447 7:4115737-4115759 GACAGAAGCAGGGAGGCTCTGGG - Intronic
1020073628 7:5243390-5243412 GTCAGCACCAAGGAGGCTGCAGG - Intergenic
1020256307 7:6504543-6504565 GAGAGAGGGAATGAGGCTGGAGG + Intronic
1020952066 7:14692293-14692315 GAGAGAAGGAGGGAAGATGCAGG - Intronic
1021729781 7:23585121-23585143 GGGAGAAGAAAGGATGCTGAAGG + Intergenic
1022056021 7:26735101-26735123 GAGAGAGGGAAGGATGCTGTGGG - Intronic
1022089526 7:27098350-27098372 GAGAGAAGAAGAGAGGCTGAGGG - Intergenic
1022109530 7:27219965-27219987 TGGAGATGCAAGGAGGATGCTGG + Intergenic
1022218728 7:28291055-28291077 GAAAGAAGAAATGAGGCTGGGGG - Intergenic
1022628748 7:32065294-32065316 GAGAAAAACAAGGAGTCTTCCGG - Intronic
1023609846 7:41961691-41961713 GAGAGAGGCTTGGAGGCTGGGGG + Exonic
1024008072 7:45241861-45241883 GAGACAAGCAAGGCACCTGCTGG - Intergenic
1024198416 7:47082500-47082522 TGAGGAAGCAAGGAGGCTGCAGG + Intergenic
1024300887 7:47886638-47886660 GAGAGAAGGAGTGAGGCGGCAGG - Intronic
1024613632 7:51088591-51088613 GAGAGCAGAAAGGATGCTGGAGG - Intronic
1024684023 7:51725492-51725514 GTGAGAAGCAGGGAGCCAGCTGG + Intergenic
1024759377 7:52576187-52576209 CAGAGAACCAGGAAGGCTGCTGG - Intergenic
1025210104 7:57015436-57015458 GAGAGAGGGAAGGGGGCTCCAGG - Intergenic
1025302185 7:57826691-57826713 GAGACAAGCCAGAGGGCTGCAGG + Intergenic
1025661847 7:63561415-63561437 GAGAGAGGGAAGGGGGCTCCAGG + Intergenic
1026980068 7:74521175-74521197 GAGAGAAGGAAGAAGGTTCCAGG - Intronic
1027374715 7:77537822-77537844 GGGAGAAGAAAGGAGGCCACGGG - Intronic
1027596093 7:80176280-80176302 GAGAGAAGTGAGGAAGCTGCAGG + Intronic
1027703097 7:81493601-81493623 GAAAGGAGCAAGGAGTCTTCTGG + Intergenic
1028001377 7:85502141-85502163 TAGAGCACCAAGGAGGCTCCTGG + Intergenic
1028280818 7:88925749-88925771 GAGAGTAGAAAGGATGGTGCAGG + Intronic
1028344886 7:89767542-89767564 GAAAGAAGTAAGGAAGCTGTAGG + Intergenic
1028364624 7:90013018-90013040 GGGAGCAGCAAGGGGGCTGCAGG + Intergenic
1028470118 7:91196826-91196848 GTGAGAAGAGAGAAGGCTGCTGG + Intronic
1029545215 7:101206911-101206933 GAGAGGAGGGAAGAGGCTGCAGG + Intronic
1030061068 7:105621752-105621774 GAGAGAGGCCAGGGAGCTGCTGG - Intronic
1031004013 7:116451869-116451891 GAGAGAAAAATGGATGCTGCAGG - Intronic
1031447686 7:121873845-121873867 GAGAGAAGAACGGTGGCGGCAGG - Intronic
1032207023 7:129874954-129874976 GAAAAAAGAAGGGAGGCTGCTGG + Intronic
1032284204 7:130528566-130528588 GAGAGAATGCAGGAGGGTGCAGG + Intronic
1033033028 7:137845820-137845842 GAGAGAGGCAAGGAGCACGCAGG + Intronic
1033100681 7:138468682-138468704 GAGAGAAGCAAAGATACTGGAGG - Intronic
1033421682 7:141209686-141209708 GACAGAAGCAGGGAAGCTGCTGG + Intronic
1033609852 7:142954547-142954569 GAGAGAAGCAGGGAGCATGGCGG + Intronic
1033630020 7:143148406-143148428 AAGAGAAGCAAAGAGGATGTGGG + Intergenic
1034164320 7:149014019-149014041 GAGAGAAGGAAGGAAGCGTCTGG - Intronic
1034938539 7:155215145-155215167 GGGAGAAACAAGGACCCTGCAGG + Intergenic
1035004446 7:155644762-155644784 CAGAGAAGGGAGGGGGCTGCAGG - Exonic
1035073013 7:156158592-156158614 GCGAGAAGACAGAAGGCTGCAGG - Intergenic
1035285315 7:157802258-157802280 GAGAGGAGGATGGAGGCTGCCGG - Intronic
1035323566 7:158050568-158050590 GAGGGAAGCCGGGAGGCTGTGGG - Intronic
1035382130 7:158446891-158446913 AACAGGAGCTAGGAGGCTGCAGG - Intronic
1035386938 7:158479339-158479361 GAGAGAGGGAGGGAGGCTGTCGG - Intronic
1035444762 7:158932714-158932736 GAGAGCAGTTAGGAGGCTTCTGG + Intronic
1035656182 8:1307831-1307853 GAAAGTAGAAAGGAGGCTGCCGG + Intergenic
1036578989 8:10055015-10055037 GAGACAAGAAAGGAGGGCGCAGG - Intronic
1038539892 8:28383721-28383743 CAGAGAAGTGGGGAGGCTGCTGG - Intronic
1039192339 8:34990909-34990931 GAGAAAAGTAAGAAAGCTGCAGG + Intergenic
1039652672 8:39359145-39359167 GAGAGAAGTGAGTAAGCTGCAGG + Intergenic
1040286157 8:46101455-46101477 GAGGGAAGCAGCGAGACTGCAGG - Intergenic
1040286571 8:46103549-46103571 TGGAGAAGCAATGAGGCTGCAGG - Intergenic
1040288318 8:46111628-46111650 GGGAGAAGCAGTGAGACTGCAGG - Intergenic
1040293514 8:46137500-46137522 GTGAGAAGCAGAGAGACTGCAGG - Intergenic
1040298095 8:46173702-46173724 AGGAGAAGCAATGAGACTGCAGG + Intergenic
1040300265 8:46184342-46184364 GGGAGAAGCAATGAGACCGCAGG - Intergenic
1040300784 8:46186954-46186976 GGGACAAGCCAGGAGGCTTCTGG + Intergenic
1040300947 8:46187747-46187769 GGGAGAAGCAGTGAGACTGCAGG - Intergenic
1040301207 8:46188924-46188946 GGGAGAAGCAGCGAGACTGCAGG + Intergenic
1040306658 8:46215437-46215459 GGGAGAAGCAGCGAGACTGCAGG + Intergenic
1040307941 8:46221939-46221961 GGGAGAAGCATGGAGACAGCAGG + Intergenic
1040308791 8:46225924-46225946 GGGAGAAGCGGCGAGGCTGCAGG + Intergenic
1040309486 8:46229368-46229390 AGGAGAAGCAACGAGACTGCAGG + Intergenic
1040310943 8:46236574-46236596 GAGAGAAGCGACAAGACTGCAGG + Intergenic
1040315162 8:46257122-46257144 GGGAGAAGCAGGGAGACTGCAGG + Intergenic
1040316350 8:46262922-46262944 GGGAGAAGCAACGAGACAGCAGG + Intergenic
1040324751 8:46336029-46336051 GGGAGAAGCAGTGAGACTGCAGG + Intergenic
1040329150 8:46377101-46377123 GGGAGAAGCAGCGAGACTGCAGG + Intergenic
1040330423 8:46383013-46383035 GAGAGAAGCAGTGAGACAGCAGG + Intergenic
1040330942 8:46385473-46385495 GGGAGAAGTCACGAGGCTGCAGG + Intergenic
1040336473 8:46418593-46418615 GGGAGAAGCAGCGAGACTGCAGG + Intergenic
1040338402 8:46427702-46427724 GGGAGAAGCGACGAGACTGCAGG + Intergenic
1040340503 8:46438131-46438153 GAAAGAAGCAGCGAGACTGCAGG - Intergenic
1040340755 8:46439389-46439411 AAGAGAAGCAGTGAGACTGCAGG - Intergenic
1040629516 8:49194080-49194102 GAGGGAAGAAAGGAGGCTAGAGG + Intergenic
1040816207 8:51511017-51511039 GAAAGAAGAAATGAGGCAGCGGG + Intronic
1046372266 8:113324980-113325002 GGCAGAAGCAAAGGGGCTGCAGG - Intronic
1047293747 8:123552805-123552827 GAGTGAAGGAAGGAGGTTGGGGG + Intergenic
1047546140 8:125819092-125819114 AGGTGAAGCAAGGGGGCTGCGGG + Intergenic
1047762693 8:127965891-127965913 GGGAGAGGCAAGGAGGTTACAGG + Intergenic
1047914313 8:129565596-129565618 CAGACAAGCAAGGAGACTACAGG + Intergenic
1047993747 8:130313931-130313953 GAGGGAAGCCAGCAGTCTGCAGG - Intronic
1048253521 8:132887063-132887085 GAGAGAAGCAAGGAATTTGAGGG - Exonic
1048601526 8:135923686-135923708 TAGAGAAGAGGGGAGGCTGCTGG - Intergenic
1048752492 8:137696021-137696043 GAGGGAGGCAAGGAGGTTTCTGG - Intergenic
1049001103 8:139826118-139826140 GGGAGAACCAACGAGGCTCCAGG - Intronic
1049326299 8:142023245-142023267 CAGACAAAGAAGGAGGCTGCTGG - Intergenic
1049499832 8:142955923-142955945 AGGAGCAGCAAGTAGGCTGCAGG + Intergenic
1049765025 8:144351175-144351197 GGGAAAGGCCAGGAGGCTGCAGG - Intergenic
1049841284 8:144774410-144774432 GAGAGCAGCAGGGAGTCTGGGGG - Exonic
1050728368 9:8677981-8678003 GAGAGACACAAGCAGCCTGCAGG - Intronic
1051084898 9:13337358-13337380 GAAAGAGGTAAGGAAGCTGCAGG - Intergenic
1051158662 9:14180847-14180869 TAGGCAAGCAAAGAGGCTGCTGG - Intronic
1051485339 9:17602469-17602491 GAAAGAGGCAAGGTGGCTGGTGG - Intronic
1051612527 9:18975187-18975209 TGGGGAAGCAAGGAGGCTGCAGG + Intronic
1052756460 9:32547659-32547681 GAGAGATGAAATGAGGCTGGTGG + Intronic
1053010858 9:34632326-34632348 AAGAAAAGCAAGGAGGCCACTGG + Intergenic
1053275545 9:36780591-36780613 GTGAGAACCAAGAAGACTGCAGG - Intergenic
1054720713 9:68600858-68600880 GAGAGAAGGAAGGAGTCCACTGG + Intergenic
1054826806 9:69581631-69581653 GAGTGAAGGAAGGAGTCTTCAGG + Intronic
1054906904 9:70420247-70420269 GAGAGGAGGAGGGAGGCGGCGGG - Intergenic
1055807361 9:80111441-80111463 GAGAGAAGTGAGGAAGCTGCAGG - Intergenic
1056211963 9:84373230-84373252 GAGAGGACCAAGAAGGCTGTGGG - Intergenic
1056239422 9:84629478-84629500 GAGAGACCCTAGGAGGCAGCAGG - Intergenic
1056695548 9:88847272-88847294 GAGAGAGGCAAGAAAGCTGCAGG - Intergenic
1056740659 9:89251560-89251582 GAGAGAAGCAATCAGGCAGGAGG + Intergenic
1056813654 9:89783598-89783620 TAGAGAAGAGAGGAGGCTGGAGG + Intergenic
1056907338 9:90665247-90665269 GACAGAGGCAAGGCGGTTGCAGG + Intergenic
1056943786 9:90976798-90976820 TAAAGGAGCAAGGATGCTGCGGG + Intergenic
1057994832 9:99811729-99811751 GAGGAAAGCAGGGAGGCAGCAGG + Intergenic
1058388794 9:104470765-104470787 GACAGAGGCAAGGAGGGTCCAGG + Intergenic
1058765604 9:108180102-108180124 GAGAGCCCCCAGGAGGCTGCTGG - Intergenic
1058875875 9:109244407-109244429 AAGAGAAGGAAGGAGGTTGAAGG + Intronic
1059241462 9:112809969-112809991 GAGAGTAGGATGGAGGCTCCTGG + Intronic
1060029484 9:120202043-120202065 GGGAAAAGGAAGGAGGCTTCAGG + Intergenic
1060232831 9:121838350-121838372 GAGACCAGCGAGGAGGCTGTGGG - Intronic
1060460471 9:123848929-123848951 GAGAGAGGTGAGGAAGCTGCAGG + Intronic
1060747940 9:126149922-126149944 GAGTGAGGTATGGAGGCTGCAGG + Intergenic
1060814465 9:126627316-126627338 GTCAGAAGCAAGCAGGCTGAGGG - Intronic
1060879648 9:127109059-127109081 GAGTTCAGCAAGGGGGCTGCGGG - Intronic
1060927803 9:127467446-127467468 GAGGGAGGGAAGGGGGCTGCAGG + Intronic
1061049000 9:128183129-128183151 GAGGGAGGGAGGGAGGCTGCAGG - Intronic
1061087562 9:128408201-128408223 GAGAGGAACAACGAGGCAGCTGG - Intergenic
1061673217 9:132201002-132201024 AAGACAAGCCAGGAGCCTGCAGG - Intronic
1062416056 9:136450844-136450866 TAGATAGGCAAGGAGGCTCCTGG + Intronic
1062501747 9:136854755-136854777 GAGACCAGGAAGGAGCCTGCGGG - Exonic
1062707045 9:137951517-137951539 GAGAGAAACCAGGAGGGTGGTGG - Intronic
1062724897 9:138066462-138066484 GAGAGAGGCAGGGAGGCAGGAGG + Intronic
1062725583 9:138071595-138071617 GAGAGAAGCCAGGAGGAAGGGGG + Intronic
1185714436 X:2330054-2330076 GAGAGAAGCAGAGAGACGGCGGG + Intronic
1186282689 X:8010420-8010442 GAGAGAAAGAAGCAGGCTCCAGG + Intergenic
1186407393 X:9316189-9316211 GACAGAAGCCAGGAGGCTGTGGG + Intergenic
1186429242 X:9490286-9490308 GATGGAATCAAGGAAGCTGCAGG - Intronic
1186918485 X:14249561-14249583 GAGAGAAGCCAGGAGCATGCAGG - Intergenic
1187081697 X:15996700-15996722 GGGAGAAGCTGGGAGGATGCTGG - Intergenic
1187275568 X:17813961-17813983 GAGTGAAGAGAGGAGGCTGTTGG + Intronic
1188350590 X:29125908-29125930 GAGTCAAGCAAGGTGGCTGAGGG + Intronic
1188505166 X:30874610-30874632 GTGAGTAGCAAGGATGTTGCTGG + Intronic
1188579001 X:31687344-31687366 CAGAGAAGCAGGCAGGCTTCTGG + Intronic
1189158974 X:38791041-38791063 TAGAGAACCAAAGAAGCTGCAGG + Intergenic
1189255703 X:39637296-39637318 CAGCCAAGCAAGGAAGCTGCGGG + Intergenic
1189314196 X:40042173-40042195 GACAGCAGGAAGGAAGCTGCTGG - Intergenic
1190432190 X:50388689-50388711 GTAAGAAACAATGAGGCTGCAGG - Intronic
1191728949 X:64313378-64313400 GAGAAAAGTGAGGAAGCTGCAGG - Intronic
1192152252 X:68719517-68719539 GAGATATGCCAGGAGGCTGGAGG + Intronic
1192209909 X:69121435-69121457 GAGAGGGTCACGGAGGCTGCAGG - Intergenic
1193228520 X:79013870-79013892 GAAAGAATCAAGCAGGCAGCTGG - Intergenic
1194626335 X:96230344-96230366 TAGAGCACCAAGGAGGCTTCTGG + Intergenic
1194669183 X:96708908-96708930 GAGAGCAGCAGAGAGGCTTCCGG + Intronic
1194986550 X:100495867-100495889 GGGCAAAGCAAGGAGGCTGAGGG + Intergenic
1195129148 X:101837666-101837688 AAGAGAAGCAAGGAAGGTGTGGG + Intronic
1197257030 X:124274577-124274599 GACTGAAGCAGGCAGGCTGCAGG - Intronic
1197708514 X:129650496-129650518 GAAAGAGGGAAGGAGGGTGCAGG - Intronic
1199651344 X:149947916-149947938 GGGAGAAGGAAGGAGGGCGCAGG - Intergenic
1199721215 X:150543863-150543885 GAGTGAAGCACGGAGGTTGAGGG + Intergenic
1199780059 X:151050262-151050284 GAGATAATCAAGTAGGCCGCTGG - Intergenic
1199819299 X:151428823-151428845 AAGAGTAGCCAGGAGGCTCCTGG - Intergenic
1200075215 X:153547331-153547353 GGGAGAGGCAGGGAGGGTGCTGG + Intronic
1200234511 X:154461792-154461814 GAGAGAGGCAAGGAGAGGGCAGG - Intronic
1200243309 X:154508819-154508841 GAGAAAAGAAAGGATGCTGAGGG + Intronic
1201143774 Y:11050425-11050447 GAGAGAGGTGAGGAAGCTGCAGG + Intergenic
1201286076 Y:12379772-12379794 GAGAGGACCAACGAGGCTGCAGG + Intergenic