ID: 1114462977

View in Genome Browser
Species Human (GRCh38)
Location 14:22900007-22900029
Sequence TGCCTTAATAATAAGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114462977_1114462988 16 Left 1114462977 14:22900007-22900029 CCCACCCCCTTATTATTAAGGCA 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1114462988 14:22900046-22900068 CCCTTTCACAGAGGTATTTCTGG 0: 1
1: 0
2: 1
3: 11
4: 159
1114462977_1114462985 7 Left 1114462977 14:22900007-22900029 CCCACCCCCTTATTATTAAGGCA 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1114462985 14:22900037-22900059 GTGCACCTTCCCTTTCACAGAGG 0: 1
1: 0
2: 2
3: 19
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114462977 Original CRISPR TGCCTTAATAATAAGGGGGT GGG (reversed) Intergenic
904576589 1:31508993-31509015 TGCCTTCCAGATAAGGGGGTGGG + Intergenic
904681305 1:32231240-32231262 TGCCTTAAAAAAAAAGTGGTGGG - Exonic
905985397 1:42276350-42276372 TGTCTTAAAAAAAAGGGGGCGGG + Intronic
906838393 1:49108981-49109003 TACCTGAAAAATGAGGGGGTTGG + Intronic
907842506 1:58171098-58171120 TCCCTTCCTAATAAGGGTGTGGG - Intronic
911016755 1:93341616-93341638 TGCCTAAATAATAATGGAGGTGG - Intergenic
911129618 1:94375351-94375373 TCCCTTCCTAATAAGGGTGTGGG + Intergenic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
917148470 1:171918685-171918707 TGAGTTAATAAGAAGGGGGTTGG + Intronic
918185846 1:182127194-182127216 GGCCTTAATAAACAGAGGGTGGG - Intergenic
919787966 1:201272140-201272162 TGCTTGTATAATGAGGGGGTTGG - Intergenic
920072468 1:203312314-203312336 TGTCTTAAAAATTAGGGAGTTGG + Intergenic
1063594950 10:7426222-7426244 TTCCTTAATGGCAAGGGGGTAGG - Intergenic
1064691940 10:17927347-17927369 TGCCTTAATTATATTGGGGCAGG - Intergenic
1070845626 10:79520814-79520836 TGTCTTACTTATAAGGGCGTTGG - Intergenic
1070928169 10:80239500-80239522 TGTCTTACTTATAAGGGCGTTGG + Intergenic
1075157577 10:119990692-119990714 TGCTTTAATAATCAGGAGTTTGG - Intergenic
1075609159 10:123837290-123837312 TGACTTTATAAGAAGGAGGTAGG - Intronic
1077197124 11:1287333-1287355 AGCTTTAACAAAAAGGGGGTGGG + Intronic
1080042876 11:27777430-27777452 TGTCTATAAAATAAGGGGGTTGG - Intergenic
1080201645 11:29678238-29678260 TCCCTTAAAAATGAGGGGTTAGG - Intergenic
1081194094 11:40140076-40140098 TGCCTTAATAATAAAGTTTTTGG + Intronic
1086084312 11:82939189-82939211 TGCAATAATAGTAAGGGGCTGGG + Intronic
1087009054 11:93496398-93496420 TACCTTAATAAGATGGGGGAAGG + Intronic
1087075154 11:94121639-94121661 TCCCTTCCTAATAAGGGCGTGGG - Intergenic
1087443930 11:98222011-98222033 TGCATTAAGAACAAGGAGGTGGG - Intergenic
1090392910 11:126401013-126401035 TGGGTTGATAATATGGGGGTTGG + Intronic
1093343083 12:18003208-18003230 TGCCTTAATAAAGTAGGGGTTGG + Intergenic
1094428410 12:30339863-30339885 TACCTTAATAATTCTGGGGTCGG + Intergenic
1096773928 12:53952929-53952951 TGCCTAACTGATAAGGGGCTGGG - Intergenic
1101553221 12:105782947-105782969 TGCCTAAAAAATAAGGGATTTGG - Intergenic
1103191330 12:119004620-119004642 TGCCTGTAAAAGAAGGGGGTTGG - Intronic
1114462977 14:22900007-22900029 TGCCTTAATAATAAGGGGGTGGG - Intergenic
1115173596 14:30536099-30536121 AGCCTTGTTAATATGGGGGTGGG - Intergenic
1116046779 14:39753095-39753117 TTCCATAATAATGAGGGGGAGGG - Intergenic
1116478553 14:45369437-45369459 TACCTGAAAAATAAGTGGGTTGG + Intergenic
1117552161 14:56847386-56847408 TGTGTTAATCAGAAGGGGGTTGG + Intergenic
1118305071 14:64648893-64648915 GGCCTTCAAAATAAGGTGGTGGG - Intergenic
1120105544 14:80490048-80490070 TTCCTAAACAATAAGGGGGAGGG + Intronic
1120148634 14:81006888-81006910 AGCATTAATAATAAGGTGTTAGG - Intronic
1124559867 15:30761619-30761641 TGCCTGTATAATAAAAGGGTGGG - Intronic
1124671379 15:31644099-31644121 TGCCTGTATAATAAAAGGGTGGG + Intronic
1126440772 15:48685343-48685365 GGCCTTAAAAAGAAGGTGGTGGG + Intergenic
1127453740 15:59139855-59139877 TGGATTAATAATGAGGGGGTGGG - Intronic
1127769073 15:62216184-62216206 TGCCTTAAGAATAAGCTGGCTGG + Intergenic
1129039006 15:72670028-72670050 TACCCTAATGATAAAGGGGTAGG - Intergenic
1129399520 15:75273878-75273900 TACCCTAATGATAAAGGGGTAGG - Intronic
1134149311 16:11793527-11793549 TGTCTCAAAAAAAAGGGGGTGGG + Intronic
1137902363 16:52282598-52282620 AGCCATAATAATAAGGGATTTGG - Intergenic
1137952126 16:52793368-52793390 TGCCTTGAAAATGAGGGGTTTGG - Intergenic
1138382086 16:56609521-56609543 TGCCTTAAAAATAACGGACTGGG + Intergenic
1139793310 16:69459866-69459888 TTCCTTAATATTAAGGGCTTAGG + Intronic
1141308920 16:82894344-82894366 TGCCTTAACAATAATAGGGCAGG + Intronic
1141495076 16:84403985-84404007 TGCCTTTATAATAAACTGGTAGG - Intronic
1143535444 17:7536280-7536302 TGCCTTTATACTAAGGTAGTAGG + Intergenic
1144315500 17:14057085-14057107 TGCCTTAAAACTAAGGAAGTGGG - Intergenic
1144951544 17:18997061-18997083 AGCCTTAATAGTCAGAGGGTGGG - Intronic
1148349219 17:46927842-46927864 TGACATAATAAAAAGGGGGGAGG - Intronic
1148716570 17:49720106-49720128 TGCCTCAATTATATGGGGATGGG + Intronic
1155322290 18:24631626-24631648 TGCCTTAAGAATAAAGGGAGAGG - Intergenic
1156578589 18:38349114-38349136 TGCCCTAACTATAAGTGGGTGGG - Intergenic
1156587323 18:38445684-38445706 TGCCTAAAGAATGAGGGTGTAGG - Intergenic
1158263331 18:55633358-55633380 TGTCTTTATGATATGGGGGTTGG + Intronic
1164044249 19:21521835-21521857 TGCCTTCATAATAATGGGAATGG - Intronic
1165531651 19:36407665-36407687 GGCCTTAATAATGAAGGGGCTGG - Intronic
1168537426 19:57182678-57182700 TGCCTTAAAAGTCTGGGGGTTGG - Intergenic
926425646 2:12736466-12736488 TCCCATAGTGATAAGGGGGTGGG - Intronic
927276841 2:21269156-21269178 TGCAGTAATAAGAAGTGGGTGGG - Intergenic
929825280 2:45305252-45305274 TGCCTGCAAGATAAGGGGGTGGG + Intergenic
931797107 2:65721876-65721898 TGCCTTTTTAAAAAGAGGGTGGG + Intergenic
935500026 2:103827756-103827778 TGCCTTAAAAATGAGGGGGAGGG - Intergenic
938917154 2:135953696-135953718 TGCTCTAAAAATAAGGGGGAGGG - Intronic
940077276 2:149756618-149756640 TGACTGAATAATCAGGGGATGGG - Intergenic
943379370 2:187124333-187124355 TGCATTAATAATAAAGAGATAGG - Intergenic
945904265 2:215573518-215573540 TGACTTCAAAATAAGGGGGGTGG + Intergenic
945999699 2:216471111-216471133 TGCCTAAATAATTGGGGGGTGGG + Intronic
946149021 2:217751539-217751561 TCCCTTTGTAATAAGGGGCTTGG + Intronic
948474852 2:238210808-238210830 TCCCTTCCTAATAAGGGAGTGGG + Intergenic
1169801075 20:9512516-9512538 TGCCTTAATAATAAAAGATTAGG - Intergenic
1169963426 20:11188299-11188321 TACCTTAATAAAATGGGGGCAGG - Intergenic
1170380692 20:15756585-15756607 TGCCGTCATAAAATGGGGGTGGG + Intronic
1171881225 20:30618507-30618529 AGCTTTAATCATAAAGGGGTGGG - Intergenic
1174321794 20:49747823-49747845 GGACTTAATAATAGGGGGATGGG - Intergenic
1174575705 20:51535580-51535602 TGTCTTAATAACCAGGGGGTTGG - Intronic
1176626307 21:9094957-9094979 AGCTTTAATCATAAAGGGGTGGG + Intergenic
1178835220 21:36091648-36091670 TTCCTTAAAAAAAAGGGGTTGGG - Intergenic
1180123089 21:45767038-45767060 TGCCTCAATTAAAAGGGGGGAGG - Intronic
1180343952 22:11691322-11691344 AGCTTTAATCATAAAGGGGTGGG - Intergenic
1184010881 22:41747406-41747428 AGCCTTAATAATAACGGGCCGGG + Intronic
949254885 3:2034269-2034291 TGCCTTAATCATTAGCGGATAGG + Intergenic
949404977 3:3704832-3704854 ATCTTTAATAATAAGGGGCTAGG + Intronic
949502529 3:4694965-4694987 TGCATTTACAAAAAGGGGGTGGG - Intronic
953918079 3:46933324-46933346 TGCCTTAAAAACAAGGAGGCCGG + Intronic
953969020 3:47332726-47332748 GGCCTTAAAAATAGGGGAGTGGG + Intronic
955855449 3:63267800-63267822 TGCCTTAATAAAAAGGTGTACGG - Intronic
958140121 3:89551645-89551667 TGCCTTTATAATAATGGGGCAGG + Intergenic
958781325 3:98546934-98546956 TGCCTTAAAAATAATGAGCTGGG + Intronic
959793282 3:110390952-110390974 TTCCTTAATAATCAGGGACTTGG + Intergenic
961560928 3:127729755-127729777 TGTCTCAATAATATGGGGGCTGG - Intronic
963555368 3:146780468-146780490 TGTCTTAAGAATATGGGGTTAGG - Intergenic
965442936 3:168738665-168738687 TGCCTTGAATAAAAGGGGGTAGG + Intergenic
966266943 3:178057624-178057646 TAGCATAATAATAAGAGGGTTGG + Intergenic
977884228 4:102238756-102238778 TGCCTCCCTAATAAGGGTGTGGG - Intergenic
984939655 4:184919951-184919973 TCCCTTCCTAATAAGGGTGTGGG + Intergenic
1202762375 4_GL000008v2_random:123205-123227 AGCTTTAATCATAAAGGGGTGGG - Intergenic
989722235 5:44542915-44542937 TGCCTAGAAAATAATGGGGTTGG + Intergenic
990186584 5:53216506-53216528 TGCCTAAACAATCAGGGAGTTGG + Intergenic
993718196 5:91296090-91296112 TGCCTGCATTATAAGGGGATAGG + Intergenic
995102846 5:108335577-108335599 TGCCTTAACAGAAAGGGGGAAGG + Intronic
995838212 5:116419274-116419296 TGCCTTACTGATATTGGGGTTGG + Intergenic
1001106836 5:168861484-168861506 TGCTTTTATAATAAGTGGTTTGG - Intronic
1001550494 5:172598885-172598907 TACCAGAATAATAAGGGGATGGG + Intergenic
1009311538 6:62159569-62159591 TCCCTAAATGACAAGGGGGTTGG + Intronic
1010081518 6:71869482-71869504 GGCCCTAATAAGAAGGGGGAGGG - Intergenic
1014861109 6:126469320-126469342 TGCCTTCTTCATAAGGCGGTAGG - Intergenic
1016045396 6:139475632-139475654 TGCATAAATCAGAAGGGGGTGGG + Intergenic
1016769784 6:147836125-147836147 TGCCTTGAAAATACTGGGGTTGG - Intergenic
1021595713 7:22314385-22314407 TGCCTCAGTACAAAGGGGGTCGG + Intronic
1023997040 7:45165701-45165723 TTCCTTAAGGCTAAGGGGGTTGG - Intronic
1025872874 7:65451219-65451241 TGCATTGATTAGAAGGGGGTGGG + Intergenic
1028166672 7:87546285-87546307 TGCAGTAATAATCAGGGGCTTGG + Intronic
1030739270 7:113088499-113088521 TTCCTTAAAAATAAGGGAGAGGG + Intergenic
1035915552 8:3617720-3617742 TGCCTTAACAATAAGGTAGCAGG - Intronic
1039845901 8:41325235-41325257 TGCCTTATTAATAATTGGGAAGG + Intergenic
1040481432 8:47831348-47831370 TGCATTTGTAAGAAGGGGGTAGG - Intronic
1046382533 8:113470493-113470515 TGCCTTACAGAAAAGGGGGTGGG + Intergenic
1046455168 8:114449820-114449842 TGCCTTAAAAATAATGGTCTTGG + Intergenic
1046565836 8:115899934-115899956 TGCTATAAAAATAAGGGGGTGGG - Intergenic
1046966236 8:120168857-120168879 TGCCTCAAAAAAAACGGGGTTGG - Intronic
1047279245 8:123430897-123430919 TCCCTGAAAAATAAAGGGGTGGG - Intronic
1055516331 9:77037183-77037205 TGCTTTAAGAATGAGGAGGTGGG - Intergenic
1057774449 9:97995247-97995269 TGCCTATAAAATAAGGGGTTGGG - Intronic
1058653689 9:107200485-107200507 TGCCTTATTCACAAGGTGGTAGG - Intergenic
1058892434 9:109372434-109372456 GGCCTGTATAATTAGGGGGTAGG + Intergenic
1203543139 Un_KI270743v1:108086-108108 AGCTTTAATCATAAAGGGGTGGG - Intergenic
1188569345 X:31563491-31563513 TGCATCAATAATAAGGGAGGGGG - Intronic
1190129340 X:47732768-47732790 TGTCTCAAAAATAAGGGGGGCGG - Intergenic
1194219548 X:91174780-91174802 TGCCTTGACAATAAGGGCCTTGG - Intergenic
1195277586 X:103297510-103297532 TCCCTTAATATTCAGGGAGTAGG + Intergenic
1196419247 X:115506162-115506184 TGCCTCCCTAATAAGGGTGTGGG + Intergenic
1196815260 X:119660535-119660557 TGCCTTGATAATAATGGCTTGGG - Intronic
1197277461 X:124496490-124496512 TGCTTTAATTATCATGGGGTAGG + Intronic
1198323238 X:135540758-135540780 TGTCTCAAAAAAAAGGGGGTGGG - Intronic
1200556060 Y:4638544-4638566 TGCCTTGACAATAAGGGCCTTGG - Intergenic
1201162841 Y:11180386-11180408 AGCTTTAATCATAAAGGGGTGGG + Intergenic
1201515853 Y:14818268-14818290 TCCCTTCCTAATAAGGGTGTGGG + Intronic
1201981627 Y:19915720-19915742 TCCCTTCTTAATAAGGGTGTGGG + Intergenic