ID: 1114470378

View in Genome Browser
Species Human (GRCh38)
Location 14:22957117-22957139
Sequence TGCACTAGAGGCCGCGACGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 20}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114470366_1114470378 24 Left 1114470366 14:22957070-22957092 CCGGAAAGACCAAGCTGAAAGGC 0: 1
1: 0
2: 1
3: 14
4: 168
Right 1114470378 14:22957117-22957139 TGCACTAGAGGCCGCGACGAAGG 0: 1
1: 0
2: 1
3: 0
4: 20
1114470369_1114470378 15 Left 1114470369 14:22957079-22957101 CCAAGCTGAAAGGCCCGGGAAGG 0: 1
1: 0
2: 1
3: 17
4: 148
Right 1114470378 14:22957117-22957139 TGCACTAGAGGCCGCGACGAAGG 0: 1
1: 0
2: 1
3: 0
4: 20
1114470364_1114470378 25 Left 1114470364 14:22957069-22957091 CCCGGAAAGACCAAGCTGAAAGG 0: 1
1: 0
2: 0
3: 18
4: 206
Right 1114470378 14:22957117-22957139 TGCACTAGAGGCCGCGACGAAGG 0: 1
1: 0
2: 1
3: 0
4: 20
1114470375_1114470378 1 Left 1114470375 14:22957093-22957115 CCGGGAAGGGGAAGGAGCCGAAA 0: 1
1: 0
2: 1
3: 19
4: 262
Right 1114470378 14:22957117-22957139 TGCACTAGAGGCCGCGACGAAGG 0: 1
1: 0
2: 1
3: 0
4: 20
1114470374_1114470378 2 Left 1114470374 14:22957092-22957114 CCCGGGAAGGGGAAGGAGCCGAA 0: 1
1: 0
2: 2
3: 24
4: 360
Right 1114470378 14:22957117-22957139 TGCACTAGAGGCCGCGACGAAGG 0: 1
1: 0
2: 1
3: 0
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114470378 Original CRISPR TGCACTAGAGGCCGCGACGA AGG Exonic