ID: 1114473919

View in Genome Browser
Species Human (GRCh38)
Location 14:22981417-22981439
Sequence GCAAAGCTGTTAGCTCGTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 66}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114473909_1114473919 23 Left 1114473909 14:22981371-22981393 CCGCGGGCTCCGGCTTCTCGCCC 0: 1
1: 0
2: 2
3: 12
4: 196
Right 1114473919 14:22981417-22981439 GCAAAGCTGTTAGCTCGTCCTGG 0: 1
1: 0
2: 1
3: 8
4: 66
1114473917_1114473919 -8 Left 1114473917 14:22981402-22981424 CCACCGTCAGGCGAAGCAAAGCT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1114473919 14:22981417-22981439 GCAAAGCTGTTAGCTCGTCCTGG 0: 1
1: 0
2: 1
3: 8
4: 66
1114473916_1114473919 -7 Left 1114473916 14:22981401-22981423 CCCACCGTCAGGCGAAGCAAAGC 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1114473919 14:22981417-22981439 GCAAAGCTGTTAGCTCGTCCTGG 0: 1
1: 0
2: 1
3: 8
4: 66
1114473913_1114473919 3 Left 1114473913 14:22981391-22981413 CCCACCGGTGCCCACCGTCAGGC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1114473919 14:22981417-22981439 GCAAAGCTGTTAGCTCGTCCTGG 0: 1
1: 0
2: 1
3: 8
4: 66
1114473914_1114473919 2 Left 1114473914 14:22981392-22981414 CCACCGGTGCCCACCGTCAGGCG 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1114473919 14:22981417-22981439 GCAAAGCTGTTAGCTCGTCCTGG 0: 1
1: 0
2: 1
3: 8
4: 66
1114473915_1114473919 -1 Left 1114473915 14:22981395-22981417 CCGGTGCCCACCGTCAGGCGAAG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1114473919 14:22981417-22981439 GCAAAGCTGTTAGCTCGTCCTGG 0: 1
1: 0
2: 1
3: 8
4: 66
1114473911_1114473919 14 Left 1114473911 14:22981380-22981402 CCGGCTTCTCGCCCACCGGTGCC 0: 1
1: 0
2: 0
3: 7
4: 136
Right 1114473919 14:22981417-22981439 GCAAAGCTGTTAGCTCGTCCTGG 0: 1
1: 0
2: 1
3: 8
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114473919 Original CRISPR GCAAAGCTGTTAGCTCGTCC TGG Exonic
906481031 1:46198796-46198818 GCAAGGCCGTTACCTAGTCCTGG + Intronic
907955074 1:59220605-59220627 TCACAGCTGTCAGCTCCTCCAGG - Intergenic
909262659 1:73512933-73512955 GCTGAGCTGTTAGCTAGTGCTGG - Intergenic
912542793 1:110429778-110429800 GCACATCTGTTAGCTTTTCCAGG + Intergenic
915004591 1:152624119-152624141 GAAAAGCTGTGAGCTAGTCAAGG - Intergenic
917694632 1:177509252-177509274 CCAAAGCTGTTGTCTCCTCCAGG - Intergenic
918280433 1:182998942-182998964 GAGAAGCTGTCAGCTGGTCCCGG - Intergenic
920311816 1:205053005-205053027 GTAAAGCTTTTACCTCGGCCTGG - Intronic
920647871 1:207816493-207816515 GCAGAGCTATTAGCCCTTCCTGG + Intergenic
920893572 1:210019297-210019319 GCAGAGCTGTTAGCACTTTCTGG - Intronic
924809009 1:247384672-247384694 ACAAATTTGGTAGCTCGTCCGGG - Intergenic
1064588824 10:16867172-16867194 ACAAAGCTGTTTGCTCAGCCTGG - Intronic
1065930309 10:30473207-30473229 GCAGAGCTGTTACCAAGTCCAGG + Intergenic
1067918182 10:50423219-50423241 GCAAAGATGCTATCTTGTCCTGG - Intronic
1068657711 10:59591899-59591921 GCACAGGTGTTAGCGGGTCCAGG - Intergenic
1071387097 10:85132409-85132431 GCAGAGCTGTGAGCTCCTCATGG + Intergenic
1078562118 11:12381274-12381296 ACAAAGCTGTGAGCTTATCCAGG - Intronic
1080696947 11:34610912-34610934 GCAAAGCTGTCAGCTCCTGCTGG + Intergenic
1086125679 11:83346199-83346221 CCAAGGCTGTTAGCACCTCCAGG + Intergenic
1087122553 11:94589889-94589911 GCAAAGCACTGAGCTAGTCCTGG - Intronic
1101016372 12:100505025-100505047 GCAAAGTTGTTTGCTGTTCCTGG - Intronic
1107659554 13:42625036-42625058 GCTCAGCTGTTATCTCCTCCTGG - Intergenic
1114473919 14:22981417-22981439 GCAAAGCTGTTAGCTCGTCCTGG + Exonic
1119736552 14:76986264-76986286 GCAAATCTGTTACCTCATCCAGG - Intergenic
1121138629 14:91521419-91521441 GCAAAGCTGTGAGTGAGTCCTGG + Intergenic
1122340574 14:101025672-101025694 GCAAAGCTGATATCACCTCCTGG - Intergenic
1122526108 14:102385636-102385658 GTAAAGATTTTAGCTAGTCCAGG + Intronic
1123146442 14:106135152-106135174 GGAAAGCTGTTAGCTTGCACGGG - Intergenic
1132859837 16:2064726-2064748 GCAAAGCTGTTGGCTGGGCAGGG - Intronic
1136692622 16:32046357-32046379 GGAAAGCTGTTAGCTTGTACGGG + Intergenic
1136793119 16:32989583-32989605 GGAAAGCTGTTAGCTTGCACGGG + Intergenic
1136876734 16:33864474-33864496 GGAAAGCTGTTAGCTTGTACGGG - Intergenic
1138131448 16:54483347-54483369 GCATAGCTGTCAGCTGGTCAGGG - Intergenic
1203095375 16_KI270728v1_random:1251274-1251296 GGAAAGCTGTTAGCTTGTACGGG + Intergenic
1146553246 17:33800206-33800228 GCAAAGCTGACAGATTGTCCTGG - Intronic
1146935150 17:36808535-36808557 GCAAAGCAGTTCGCTCGGCCCGG - Intergenic
1153583169 18:6595914-6595936 GCAAATCTGATAGCTGGTCCTGG - Intergenic
1153862067 18:9221855-9221877 GTAAAGCTGTTACTTCGTCACGG + Exonic
1155007234 18:21740634-21740656 GGAAAGCGGTTAGGCCGTCCTGG - Intronic
926190297 2:10722669-10722691 GCAAAGCTCTTATCTCCACCTGG - Intronic
927469474 2:23362126-23362148 GCAAAGCTGTGAGCTCTGCAAGG + Intergenic
940180339 2:150924687-150924709 TCAAAGCTGTTAGCTCCTTTGGG + Intergenic
940924482 2:159348780-159348802 GCAAAGCTTTTAGGTCCTCTGGG + Exonic
941606765 2:167607216-167607238 GCAATGCAGTTAGATCATCCTGG - Intergenic
946361297 2:219220679-219220701 GAAAAGCTGTTACCTCACCCTGG + Intronic
946736716 2:222761180-222761202 GGCAAGCTCTTAGCTCCTCCAGG - Intergenic
1169179134 20:3546978-3547000 GCAGAACTGTTAGCTCCTCATGG - Intronic
1171161852 20:22933165-22933187 AGAAATCTGTTAGCTCTTCCTGG + Intergenic
1174985213 20:55443863-55443885 GCAAAGCTGTTACCACCTCCAGG - Intergenic
1178674624 21:34620708-34620730 GCAAAACAGTTAACTGGTCCTGG - Intergenic
1180186502 21:46142518-46142540 GCACAGCTGTTAGCTCCTCCCGG + Intronic
956026933 3:64993065-64993087 GCATACCTGTTAGCTCCTCAGGG + Intergenic
956221199 3:66905327-66905349 GCATAGCTGTTATCTGGTTCGGG - Intergenic
967744092 3:193035588-193035610 GCAAAGCTGTTGTCTCCTTCAGG + Intergenic
979529192 4:121750779-121750801 GCAAAGCTGTATGCACCTCCCGG + Intergenic
980864478 4:138538753-138538775 GCAAAGCTCTTAACTAATCCAGG + Intergenic
987124014 5:14794127-14794149 CCAAAGCTGTTAGGACTTCCTGG - Intronic
988161675 5:27525447-27525469 GCAAAGCTGTAAACTCCTTCAGG + Intergenic
996039207 5:118791793-118791815 GCCAAGCTTTTAGCTTGTCAAGG - Intergenic
1003533611 6:6957190-6957212 GCAAAGCTGGGAGTTCCTCCGGG + Intergenic
1005884977 6:30090755-30090777 GCAAAGCTGTTACCTGTGCCTGG + Intergenic
1017498058 6:154998802-154998824 GGAAATCTGAAAGCTCGTCCTGG - Intronic
1018510345 6:164518137-164518159 GCATAGCTGTTTGTTCTTCCTGG + Intergenic
1019709453 7:2511639-2511661 GGAAAGCTGTTTGCTCAGCCGGG - Intergenic
1022103945 7:27185316-27185338 GACAAGCTGCTAGCTAGTCCGGG + Intergenic
1043107730 8:76136061-76136083 GCAAAGCTGTAAGGTCACCCTGG + Intergenic
1046690533 8:117279522-117279544 GTAAAGCTGTAAGATCCTCCAGG - Intergenic
1049018644 8:139939237-139939259 GCAGAGGTGTTATCTCTTCCAGG - Intronic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1054815457 9:69470573-69470595 CCAAAACTGTGAGCTTGTCCTGG + Intronic
1055864347 9:80794881-80794903 GGCAAGATGTTAGCTCCTCCAGG + Intergenic
1056332128 9:85529618-85529640 GCACAGCTGTTGGCACCTCCTGG + Intergenic
1059644579 9:116251906-116251928 GGACCGCTGTTACCTCGTCCCGG + Intronic
1193427959 X:81363515-81363537 GCAAAGGTATTACCTCTTCCAGG + Intergenic
1195997066 X:110741894-110741916 GCCAAGCAGATAGCTCCTCCAGG - Intronic
1199085697 X:143628606-143628628 TCAAAGCTGTTTGCTCCTCAAGG + Exonic